ID: 1007142479 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:39589659-39589681 |
| Sequence | GAGGAACATCAGATCTGCGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 108 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 6, 4: 100} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1007142469_1007142479 | 24 | Left | 1007142469 | 6:39589612-39589634 | CCCTATGTGGGGTTTGGAGGTGA | 0: 1 1: 0 2: 0 3: 19 4: 131 |
||
| Right | 1007142479 | 6:39589659-39589681 | GAGGAACATCAGATCTGCGGGGG | 0: 1 1: 0 2: 1 3: 6 4: 100 |
||||
| 1007142470_1007142479 | 23 | Left | 1007142470 | 6:39589613-39589635 | CCTATGTGGGGTTTGGAGGTGAG | No data | ||
| Right | 1007142479 | 6:39589659-39589681 | GAGGAACATCAGATCTGCGGGGG | 0: 1 1: 0 2: 1 3: 6 4: 100 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1007142479 | Original CRISPR | GAGGAACATCAGATCTGCGG GGG | Intronic | ||