ID: 1007142479

View in Genome Browser
Species Human (GRCh38)
Location 6:39589659-39589681
Sequence GAGGAACATCAGATCTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007142469_1007142479 24 Left 1007142469 6:39589612-39589634 CCCTATGTGGGGTTTGGAGGTGA 0: 1
1: 0
2: 0
3: 19
4: 131
Right 1007142479 6:39589659-39589681 GAGGAACATCAGATCTGCGGGGG 0: 1
1: 0
2: 1
3: 6
4: 100
1007142470_1007142479 23 Left 1007142470 6:39589613-39589635 CCTATGTGGGGTTTGGAGGTGAG No data
Right 1007142479 6:39589659-39589681 GAGGAACATCAGATCTGCGGGGG 0: 1
1: 0
2: 1
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007142479 Original CRISPR GAGGAACATCAGATCTGCGG GGG Intronic