ID: 1007151836

View in Genome Browser
Species Human (GRCh38)
Location 6:39701256-39701278
Sequence AGTCCTGGTCCAGCCCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007151829_1007151836 3 Left 1007151829 6:39701230-39701252 CCTATGGGATAGCCACCTCCTAG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1007151836 6:39701256-39701278 AGTCCTGGTCCAGCCCCCACGGG No data
1007151832_1007151836 -9 Left 1007151832 6:39701242-39701264 CCACCTCCTAGGCAAGTCCTGGT 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1007151836 6:39701256-39701278 AGTCCTGGTCCAGCCCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007151836 Original CRISPR AGTCCTGGTCCAGCCCCCAC GGG Intronic
No off target data available for this crispr