ID: 1007152554

View in Genome Browser
Species Human (GRCh38)
Location 6:39708455-39708477
Sequence TACAATAAGGCCAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007152554_1007152560 14 Left 1007152554 6:39708455-39708477 CCAACCTCATTGGCCTTATTGTA 0: 1
1: 0
2: 1
3: 17
4: 217
Right 1007152560 6:39708492-39708514 GCTGTTCAGCACCAGCTACTGGG 0: 1
1: 0
2: 0
3: 14
4: 164
1007152554_1007152559 13 Left 1007152554 6:39708455-39708477 CCAACCTCATTGGCCTTATTGTA 0: 1
1: 0
2: 1
3: 17
4: 217
Right 1007152559 6:39708491-39708513 AGCTGTTCAGCACCAGCTACTGG 0: 1
1: 0
2: 0
3: 18
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007152554 Original CRISPR TACAATAAGGCCAATGAGGT TGG (reversed) Intronic
901773719 1:11544775-11544797 TAAAACAAGGCCATTGAGATGGG + Intergenic
902672148 1:17982162-17982184 TAAGGTAAGGCCAATGAGGTGGG - Intergenic
903143799 1:21356661-21356683 TACAATGAAGGAAATGAGGTGGG - Intergenic
904737229 1:32643893-32643915 TACAACAAGGCCAAGGTGGAAGG - Intronic
906222135 1:44089113-44089135 TAAAATAAGGGCAATAAGGCAGG + Intergenic
907225630 1:52943618-52943640 TTCAAAAAGGCCAACGAGATAGG + Intronic
908621327 1:65983510-65983532 TAAAATAAGGTCATTAAGGTGGG + Intronic
909045289 1:70702230-70702252 TAAAATAAGGCCATTAGGGTGGG + Intergenic
909679065 1:78271009-78271031 AGCAAGAAGGCCAATGTGGTTGG - Intergenic
909999004 1:82319266-82319288 TAAAATGAGGCCATTGAGGTGGG - Intergenic
910050723 1:82971048-82971070 TAAAATAAGGGCATTAAGGTGGG + Intergenic
910803699 1:91170092-91170114 TAGAATGAGTCCCATGAGGTTGG - Intergenic
911004108 1:93199776-93199798 TACCAGAACGCAAATGAGGTGGG - Intronic
912965706 1:114235401-114235423 TACTAGAAAGCCAATGGGGTGGG - Intergenic
913232078 1:116748331-116748353 TTGAATAAGGCCAATTAGGCAGG - Intergenic
913701686 1:121380593-121380615 CATAATAACCCCAATGAGGTTGG - Intronic
914042247 1:144061062-144061084 CATAATAACCCCAATGAGGTTGG - Intergenic
914135843 1:144899426-144899448 CATAATAACCCCAATGAGGTTGG + Intronic
915472900 1:156136419-156136441 CGCAACAAGTCCAATGAGGTAGG + Exonic
915854422 1:159366603-159366625 TACAATTAGGCCAATGCTGCAGG - Intergenic
915921771 1:159981147-159981169 TAAAATAAGGCCATTAGGGTGGG + Intergenic
920489110 1:206399313-206399335 CATAATAACCCCAATGAGGTTGG - Intronic
921433251 1:215086789-215086811 TATGTTAAGGCAAATGAGGTGGG - Intronic
923851337 1:237799059-237799081 AACAATATGACCAATGAGATAGG - Intronic
924111951 1:240708816-240708838 TGCAATAAGGCCAGAGAGATGGG - Intergenic
924427497 1:243966257-243966279 TAAAATAAGGAAAATGAAGTAGG - Intergenic
924547307 1:245041719-245041741 TAAAATGAGGCCATTGGGGTGGG + Intronic
1063977879 10:11431478-11431500 TGCAATAAGGCCCTTGATGTGGG + Intergenic
1065045234 10:21741719-21741741 TATAAAAAGACCAAAGAGGTGGG - Intronic
1067777274 10:49172691-49172713 TGCAATGAGGCCATTGAGCTGGG - Intronic
1071477588 10:86037963-86037985 TAAAATAAGGTCATTAAGGTGGG + Intronic
1074959153 10:118423705-118423727 TTCATTAAGGAAAATGAGGTTGG - Intergenic
1078374804 11:10784947-10784969 AGCAATTAGGCCAAGGAGGTGGG + Intergenic
1079379154 11:19921789-19921811 TGCTATAAATCCAATGAGGTAGG - Intronic
1079442541 11:20529656-20529678 TAAAATAAGGACAATTAGGCTGG - Intergenic
1080708132 11:34718769-34718791 TAAAAGAAGGCCAATGTGGCTGG + Intergenic
1081108693 11:39104834-39104856 TAAAATAAGGTCATTTAGGTGGG - Intergenic
1082243921 11:49898596-49898618 AACAGTAAGGCCAATAAAGTAGG + Intergenic
1085333181 11:75669345-75669367 TAAAATAGGGCCAATGGGGGGGG + Intergenic
1085829152 11:79881163-79881185 CACAATAATACCTATGAGGTAGG + Intergenic
1085872742 11:80369477-80369499 TACAACAAACCCAAAGAGGTAGG + Intergenic
1086185488 11:84009824-84009846 TAAAATAAAACCAATGAGGCAGG + Intronic
1086614586 11:88801044-88801066 TACAATATAGCCAATGACTTTGG - Intronic
1087453779 11:98357079-98357101 TACAATTAGGCTAATGTGCTTGG + Intergenic
1087797428 11:102469418-102469440 CACAAAAAGGTCAAAGAGGTTGG + Intronic
1088153809 11:106780223-106780245 AACAATAGGACCAAAGAGGTAGG + Intronic
1088158060 11:106833183-106833205 TACAATGAGGCCAGTAGGGTGGG - Intronic
1089981901 11:122779603-122779625 TACAAAGAGGCCGATGAAGTTGG - Exonic
1091062390 11:132475474-132475496 TACAATGAGGCCATTAGGGTGGG + Intronic
1092570719 12:9718638-9718660 TACAGTGAGGCCATTGCGGTGGG + Intronic
1093894340 12:24560880-24560902 CACAAACAGGCCAATGAAGTAGG - Intergenic
1094620701 12:32077798-32077820 CACAATCAGCCCAATGTGGTAGG + Intergenic
1094638539 12:32250314-32250336 CACAATAACCCCACTGAGGTAGG - Intronic
1095883495 12:47164510-47164532 TGCAGCAAGGCCATTGAGGTGGG - Intronic
1097936473 12:65257541-65257563 TAAAATTAGGCCAATTAGGCTGG - Intergenic
1100887799 12:99091793-99091815 CACAATAACTCCTATGAGGTAGG + Intronic
1101945003 12:109129994-109130016 CACAATAAGGCAGGTGAGGTAGG + Intronic
1103116363 12:118336773-118336795 TACAAAAAGGGCAAAGAGGCTGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107061530 13:36164652-36164674 AAAAAGAAGGCCAATGGGGTTGG - Intergenic
1109148914 13:58819207-58819229 TAAATTAAGGCAAATGAGGATGG - Intergenic
1109276644 13:60311263-60311285 GACAAAAAGACCAATGAGGAGGG + Intergenic
1110051481 13:70906654-70906676 TACTATCAAGACAATGAGGTAGG + Intergenic
1110991155 13:82044606-82044628 TAAAATAAGGTCTATGAGGAAGG + Intergenic
1112066395 13:95797580-95797602 TGAAAGAAGGCCCATGAGGTTGG - Intergenic
1112907500 13:104442970-104442992 TACAAGGAGACCAATGAGGAAGG + Intergenic
1114218896 14:20679670-20679692 TAAAATGAGGCCATTAAGGTGGG + Intergenic
1118077711 14:62319021-62319043 ACCAATAAGGCCAATGTGTTGGG + Intergenic
1121171362 14:91857103-91857125 TACAATGAGGACTCTGAGGTTGG - Intronic
1126140425 15:45433559-45433581 TACAATGAGGAAAATGAAGTGGG + Intronic
1129779121 15:78257871-78257893 TACAAAAAGCCCAATAGGGTGGG - Intergenic
1130437648 15:83917824-83917846 TTCATTAAGCCTAATGAGGTAGG - Intronic
1130698607 15:86156426-86156448 TAAAATGAGGCCATTAAGGTGGG - Intronic
1131266695 15:90919683-90919705 TACAGTAACGTCAAGGAGGTTGG - Exonic
1133185407 16:4093252-4093274 AACAACATGGCAAATGAGGTTGG + Intronic
1135012991 16:18900713-18900735 TGCACTAAAGCCAATGAAGTAGG + Intronic
1135319912 16:21488285-21488307 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135372748 16:21919772-21919794 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135439034 16:22450929-22450951 TGCACTAAAGCCAATGAAGTAGG - Intergenic
1136330143 16:29569997-29570019 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1136444768 16:30309702-30309724 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1137858562 16:51821888-51821910 TGCAACAAGGCCAATAAGGTGGG - Intergenic
1143055857 17:4161267-4161289 TACTATAAGCCCCCTGAGGTCGG - Intronic
1143368021 17:6421081-6421103 TACATTAAGGGCCTTGAGGTGGG + Intronic
1143929502 17:10407144-10407166 AACAAAAAGGCCAAAGTGGTTGG + Intronic
1143979421 17:10855258-10855280 TGCCAAAAGACCAATGAGGTAGG - Intergenic
1145056588 17:19707369-19707391 TAAAATGGGGCTAATGAGGTGGG + Intronic
1145114855 17:20199646-20199668 TAAAATAAGGCCAAGGCAGTAGG - Intronic
1145880660 17:28350551-28350573 TACAGTAGCGCCACTGAGGTGGG + Exonic
1147842284 17:43380272-43380294 TTGAATAAGGCCAATTAGGCAGG - Intergenic
1149038586 17:52159919-52159941 TTCAATAACCCCAAAGAGGTAGG - Intronic
1149225822 17:54469297-54469319 TACTATAAAGTCAATGAGATAGG + Intergenic
1149743545 17:59072061-59072083 TAAAATGAGGCCACTGGGGTAGG + Intronic
1149751090 17:59146045-59146067 TACAATTAGGCAAATTAAGTGGG + Intronic
1151090444 17:71433401-71433423 TAAAATAAGCCCAATAAGTTAGG - Intergenic
1153358086 18:4160521-4160543 CACAATAAGCCTAATGAGGTAGG + Intronic
1155489891 18:26390302-26390324 TACAATTTGGCAAATGAGGCAGG - Exonic
1156183770 18:34637830-34637852 CAGAATAAGGCCAATTAGCTGGG + Intronic
1158341696 18:56473185-56473207 TACAATGAGGCCAGTAGGGTGGG - Intergenic
1163823689 19:19511026-19511048 AACAAAAAGGGCAATGTGGTGGG + Intergenic
1165848912 19:38837557-38837579 TGCAATTAGGGCAAGGAGGTGGG + Intronic
1166337252 19:42115831-42115853 TAAAATGAGGTCAATGGGGTGGG + Intronic
1167560096 19:50221828-50221850 GACAGAAAGGCCAGTGAGGTTGG - Intronic
1168592465 19:57648756-57648778 TACAAAACTGCCAATGAGGTAGG - Intergenic
928331803 2:30363391-30363413 TAAAATAAGGTAATTGAGGTTGG + Intergenic
931147227 2:59532708-59532730 TAAAATGAGGCCAATAAGATGGG - Intergenic
934608050 2:95713063-95713085 TGCAACCAGGCCAATGAGGTCGG - Intergenic
935321333 2:101892209-101892231 TGCATTAAGAACAATGAGGTAGG - Intronic
936256786 2:110922968-110922990 TATAATGGGGACAATGAGGTGGG - Intronic
936541389 2:113354950-113354972 TGCAACCAGGCCAATGAGGTTGG - Intergenic
937455017 2:122033652-122033674 TACAATCTAGCCAAAGAGGTAGG - Intergenic
938658001 2:133455341-133455363 TACAATAAGGCCTAGAAGGGAGG - Intronic
941741571 2:169040875-169040897 TACCATCAAGCCAAGGAGGTGGG - Intergenic
941933444 2:170965011-170965033 GACTACAAGGCCACTGAGGTGGG - Intronic
945050616 2:205820903-205820925 GAGAATTAGGCCAATGAAGTGGG + Intergenic
946352701 2:219165671-219165693 TACAACAAGGCCAGTGTGGCAGG - Intronic
946579006 2:221106346-221106368 TACAATAAGGCAGTTGAGATAGG - Intergenic
947053870 2:226078165-226078187 TAAAATAAGGTCAATAGGGTGGG + Intergenic
1168922979 20:1556580-1556602 TAAAATGAGGTCATTGAGGTGGG + Intronic
1170564900 20:17593749-17593771 TAAGATAAGGCTAAAGAGGTAGG + Intronic
1171003010 20:21433796-21433818 TACCATAAGCACAATGAGGGTGG - Intergenic
1172291686 20:33781423-33781445 TATAATAAGGGCAAGGAGGTGGG + Intronic
1173277839 20:41599849-41599871 TGGAATAAGGCCAATTAGGCGGG - Intronic
1174225322 20:48994165-48994187 AACAGTGAGGCCAATGAGGCTGG + Intronic
1175371877 20:58497647-58497669 TAAAATGAGGCCATTCAGGTGGG - Intronic
1177148696 21:17433038-17433060 TAAAATGAGGCCATTAAGGTGGG + Intergenic
1177753871 21:25321257-25321279 TACAAAAAGGGCAATGTAGTTGG + Intergenic
1180612381 22:17106395-17106417 GACTACAAGGCTAATGAGGTGGG - Intronic
1181629945 22:24145543-24145565 TACAAGAGGGCCGAGGAGGTGGG + Intronic
1184059404 22:42073108-42073130 TGCAAGAAGGCCAGTGAGGCTGG - Intergenic
1184175458 22:42786359-42786381 TACAAAAAGGGCTAGGAGGTGGG + Intergenic
1184863243 22:47188804-47188826 ACAAATAAGGACAATGAGGTTGG + Intergenic
949706186 3:6820134-6820156 AACACTAAGGAAAATGAGGTGGG - Intronic
951159391 3:19398486-19398508 GGCAATGAGGCCAAAGAGGTAGG + Intronic
956221511 3:66908951-66908973 TACAATATGGCCTTTGGGGTTGG + Intergenic
956225018 3:66947660-66947682 TGCAAGGAGGCCAATGAGGCTGG - Intergenic
958143285 3:89590426-89590448 TAAGATAAGGCCAATAAGGTAGG - Intergenic
959005749 3:101017924-101017946 CAAAATATGGGCAATGAGGTTGG + Intergenic
959713650 3:109409771-109409793 TTCAAAAAGGCCAACCAGGTAGG + Intergenic
960438418 3:117656218-117656240 TAAAATAAGGCCATTATGGTGGG + Intergenic
960908556 3:122625580-122625602 TAAAATGAGGCCATTAAGGTGGG + Intronic
961621556 3:128228529-128228551 AACAAGAAGGCCAGTGTGGTTGG - Intronic
963390993 3:144664179-144664201 TAAAATAAGGTCATTGGGGTGGG + Intergenic
963937162 3:151066598-151066620 TACAATGAGGCCAGTCTGGTTGG + Intergenic
965192936 3:165554914-165554936 TAAAATAAGGTCACTAAGGTGGG - Intergenic
967551819 3:190804338-190804360 TACAATAAGGTACATGAGGTGGG - Intergenic
969040449 4:4291411-4291433 TAAAATGAGGCCATTAAGGTGGG - Intronic
969855168 4:9993357-9993379 TCAAATAAAGCCAATGAGGTTGG + Intronic
972930647 4:44067986-44068008 TACAATAAGGTCATTGAAGTGGG + Intergenic
973783614 4:54314699-54314721 TGCAATGAGGCCCGTGAGGTTGG - Intergenic
974369803 4:61000828-61000850 TTCAAGAAGTCCAGTGAGGTTGG + Intergenic
974411229 4:61543241-61543263 TAAATTAAGGACATTGAGGTAGG + Intronic
974437419 4:61874436-61874458 TAGAATAAGGCTAAGGTGGTGGG - Intronic
977569843 4:98617706-98617728 TACAATAACAACAGTGAGGTGGG - Intronic
978096096 4:104780318-104780340 TACAAAAATGCCAATGGGGTGGG + Intergenic
978149543 4:105416337-105416359 TATAATAAGGGCAAAGAGATAGG - Intronic
979341562 4:119530579-119530601 TACAATTAGGAAAAAGAGGTGGG - Intronic
979562572 4:122116953-122116975 TGCAATGAGGGCAAAGAGGTAGG + Intergenic
981016725 4:139981287-139981309 TAAAATGAGGCCATTGGGGTAGG - Intronic
981291331 4:143079779-143079801 TAGAGTAAGGCCAATGAAGATGG - Intergenic
981657227 4:147125433-147125455 TACAGTCAGTCCAATGAGGGAGG + Intergenic
981662048 4:147179140-147179162 TAAAATGAGGCCATTGAGGTAGG + Intergenic
982293495 4:153803584-153803606 TAAAATTAGGTCATTGAGGTTGG - Intergenic
983828296 4:172293160-172293182 TTCATCAAGGCCAATGTGGTTGG - Intronic
984145252 4:176052628-176052650 TACAATTAGGCCAAGGCTGTGGG + Intergenic
985567336 5:625934-625956 TACCATGAGGCCATTAAGGTGGG - Intronic
988692009 5:33581795-33581817 TACAATAAGGTCATTAGGGTGGG + Intronic
990471637 5:56121199-56121221 CACAATAAGGCAAGTGGGGTGGG + Intronic
992271014 5:75062956-75062978 TACAATAAGGTCATTGGGGGGGG - Intergenic
994757350 5:103810841-103810863 TAAAATAAGACCAATGTGGCTGG - Intergenic
995241933 5:109895070-109895092 AACAAAATGGCCATTGAGGTAGG - Intergenic
995244777 5:109923121-109923143 TACCATAAGGAAAATGAGGTGGG - Intergenic
996496651 5:124164698-124164720 TCCAATAAGGAGAATGATGTTGG + Intergenic
998361194 5:141589234-141589256 TCCCATAAGGCCAATGAGAATGG + Intronic
1000558683 5:162758602-162758624 TCAAATAAGGACAAGGAGGTAGG + Intergenic
1001437522 5:171711848-171711870 TACTCCAAGGCCAGTGAGGTAGG - Intergenic
1003025327 6:2550068-2550090 TACAAAAAGGCCTCGGAGGTGGG - Intergenic
1003479734 6:6519921-6519943 TACAAGAAGACCAATCTGGTCGG + Intergenic
1005333574 6:24771739-24771761 TTCAATAAGGCAAAGGTGGTGGG - Intergenic
1006225505 6:32533385-32533407 AACACTAAGGCCCATGAGGAAGG - Intergenic
1007152554 6:39708455-39708477 TACAATAAGGCCAATGAGGTTGG - Intronic
1007977206 6:46113766-46113788 TAAAATGAGGCCACAGAGGTTGG + Intergenic
1008205443 6:48650913-48650935 GAAAACAAGGCCATTGAGGTAGG + Intergenic
1008573031 6:52833079-52833101 TGCAATAAGGCAACAGAGGTGGG - Intronic
1009744500 6:67796058-67796080 TACAATAAGCTGAATGAGCTTGG + Intergenic
1010062652 6:71642449-71642471 TACAATTAGGCCAGTCAAGTGGG - Intergenic
1010465594 6:76164446-76164468 TGCAAGAAGGCCAATGTGGCTGG + Intergenic
1011146076 6:84218279-84218301 TGCAAAAAGGCCAGTGAGGCTGG + Intronic
1013506284 6:110803667-110803689 TACAATAACTACACTGAGGTTGG + Intronic
1015225710 6:130854733-130854755 TAGAATAAGTCCTATGAGTTAGG + Intronic
1016006236 6:139091853-139091875 TAAAATGAGGTCATTGAGGTGGG + Intergenic
1017017078 6:150110122-150110144 TAAAATGAGGCCATTGGGGTGGG + Intergenic
1018176489 6:161182730-161182752 TACAATAAGGCCTGAGAGGCGGG + Intronic
1019936174 7:4259599-4259621 TACAAGAAGACCAATGTGTTTGG - Intronic
1019948801 7:4353823-4353845 TATAATAAGATCAATGAGGCCGG + Intergenic
1022201786 7:28124131-28124153 TAAAATGAGGCCATTAAGGTGGG + Intronic
1022232905 7:28431170-28431192 TAGAATATGGCAAATGAGATGGG - Intronic
1027264183 7:76484921-76484943 CACATTCAGGCCCATGAGGTTGG + Intronic
1027315552 7:76983035-76983057 CACATTCAGGCCCATGAGGTTGG + Intergenic
1027501849 7:78961724-78961746 TAAAATTAGGCCAATGAATTAGG - Intronic
1027529623 7:79314259-79314281 TAAAATAAGGCCAAGAAGGGTGG - Intronic
1027720884 7:81740040-81740062 TGCAATTAGGCCAGTGAGGAAGG - Intronic
1031101611 7:117487267-117487289 CACAATAAGGCCAAACAAGTGGG - Intronic
1032465414 7:132141397-132141419 TACGATGGGGCCCATGAGGTGGG - Intronic
1035257996 7:157644163-157644185 TAAAATGAGGCCACTGGGGTTGG + Intronic
1037113429 8:15194509-15194531 TAAACTAAGGGCACTGAGGTGGG + Intronic
1038224763 8:25645539-25645561 TACAATGAGGTCAATTAGCTAGG + Intergenic
1038993012 8:32890097-32890119 CACAATGAGAGCAATGAGGTTGG - Intergenic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1041949065 8:63479711-63479733 AACAAGAAGGCCAATGTGGGTGG + Intergenic
1042433334 8:68734600-68734622 TACAATAATGGCAATGAGGTGGG - Intronic
1043033747 8:75170887-75170909 TAAAATGAGGCCACTGGGGTGGG + Intergenic
1043172026 8:76977581-76977603 TACAATATGGCCAATTGGTTTGG + Intergenic
1043774388 8:84246583-84246605 TGCCAGAAGGCCAATGTGGTTGG + Intronic
1043808055 8:84698898-84698920 TACAATCTGGCCACTGAGGAAGG + Intronic
1046585015 8:116140513-116140535 TAAAATAAGGTCATTAAGGTGGG + Intergenic
1050251227 9:3747015-3747037 TACAATAATGGGAATGAGGGTGG + Intergenic
1051466389 9:17382859-17382881 AAAGATAAGGCTAATGAGGTAGG - Intronic
1051569762 9:18542487-18542509 TAAAATAAGGTCATTAAGGTGGG + Intronic
1051898504 9:22013173-22013195 TAAAATAAGGCCATTGGGGTGGG - Intronic
1054925872 9:70588369-70588391 TACAATAGGGCCCTTGGGGTGGG - Intronic
1055525999 9:77134520-77134542 TACAATGAGGCCATTAGGGTAGG + Intergenic
1055696057 9:78885525-78885547 TAAAATAAGGTCTTTGAGGTTGG - Intergenic
1059291404 9:113227548-113227570 TACAAGAATGCAAATGAGGCTGG - Intronic
1059943981 9:119387274-119387296 TGCAAAAATGCCACTGAGGTTGG - Intergenic
1059953864 9:119495892-119495914 CAAAATAAGGCCAGTGAGGCTGG + Intronic
1062256197 9:135622735-135622757 TAAAATGAGGTCACTGAGGTGGG - Intergenic
1187440027 X:19309979-19310001 AACAAGAAGGCCAATGTGGGTGG + Intergenic
1188039476 X:25355310-25355332 AACATTAAGGTCAATGAGGATGG + Intergenic
1188323915 X:28775752-28775774 ATAAATAAGGCCAATGTGGTTGG - Intronic
1189258043 X:39655477-39655499 TAGAATTGGGCCAATCAGGTTGG - Intergenic
1189835276 X:45014388-45014410 TACCGTAAGTCCAATGAGGATGG - Intronic
1192438498 X:71157259-71157281 TAAAATAAGGCCCTTGAGGTGGG - Intronic
1193770245 X:85579668-85579690 CAAAATAAGGCTATTGAGGTAGG - Intergenic
1198033309 X:132776685-132776707 GACAATGAGGCGAATAAGGTAGG - Intronic
1201226354 Y:11822634-11822656 TAGAATAAGTCAAATAAGGTAGG - Intergenic