ID: 1007158681

View in Genome Browser
Species Human (GRCh38)
Location 6:39771234-39771256
Sequence CAGGGTAGGGTGGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007158681_1007158690 -3 Left 1007158681 6:39771234-39771256 CCATCCTCCTCCACCCTACCCTG No data
Right 1007158690 6:39771254-39771276 CTGGACCTTCCTAAGCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007158681 Original CRISPR CAGGGTAGGGTGGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr