ID: 1007159550

View in Genome Browser
Species Human (GRCh38)
Location 6:39777959-39777981
Sequence GAGAACATGGAGAAGGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007159550_1007159554 8 Left 1007159550 6:39777959-39777981 CCTGAGACCTTCTCCATGTTCTC No data
Right 1007159554 6:39777990-39778012 TCTTTCCCCTCCCTTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007159550 Original CRISPR GAGAACATGGAGAAGGTCTC AGG (reversed) Intergenic
No off target data available for this crispr