ID: 1007159554

View in Genome Browser
Species Human (GRCh38)
Location 6:39777990-39778012
Sequence TCTTTCCCCTCCCTTGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007159551_1007159554 1 Left 1007159551 6:39777966-39777988 CCTTCTCCATGTTCTCCATGTTT No data
Right 1007159554 6:39777990-39778012 TCTTTCCCCTCCCTTGTCTGTGG No data
1007159550_1007159554 8 Left 1007159550 6:39777959-39777981 CCTGAGACCTTCTCCATGTTCTC No data
Right 1007159554 6:39777990-39778012 TCTTTCCCCTCCCTTGTCTGTGG No data
1007159552_1007159554 -5 Left 1007159552 6:39777972-39777994 CCATGTTCTCCATGTTTGTCTTT No data
Right 1007159554 6:39777990-39778012 TCTTTCCCCTCCCTTGTCTGTGG No data
1007159549_1007159554 17 Left 1007159549 6:39777950-39777972 CCTGGCTGGCCTGAGACCTTCTC No data
Right 1007159554 6:39777990-39778012 TCTTTCCCCTCCCTTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007159554 Original CRISPR TCTTTCCCCTCCCTTGTCTG TGG Intergenic
No off target data available for this crispr