ID: 1007161150

View in Genome Browser
Species Human (GRCh38)
Location 6:39792629-39792651
Sequence TTTGCAGGAGCCGCCGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007161147_1007161150 9 Left 1007161147 6:39792597-39792619 CCGCAGGCTGGCGGTTTTGTTTC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1007161150 6:39792629-39792651 TTTGCAGGAGCCGCCGACCCCGG 0: 1
1: 0
2: 4
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007161150 Original CRISPR TTTGCAGGAGCCGCCGACCC CGG Intronic
900147621 1:1165311-1165333 CTAGCAGGAGAGGCCGACCCTGG - Intergenic
901417634 1:9128601-9128623 TTTCCAGGAGCCCCCGACACAGG - Intronic
905326764 1:37158494-37158516 TGTCCAGGAGCCTCCAACCCTGG - Intergenic
914216209 1:145631691-145631713 TTTGCAGCAGTCGCCGTTCCAGG - Exonic
914468780 1:147954349-147954371 TTTGCAGCAGTCGCCGTTCCAGG - Exonic
922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG + Intronic
1063047268 10:2405096-2405118 TTTGCAGCACCTGCCGAGCCGGG + Intergenic
1067688205 10:48480589-48480611 TTTGCTGGAGCCTGTGACCCAGG + Intronic
1074722086 10:116272427-116272449 TTTCCAGGGGCCGCTGACACGGG + Intronic
1075707231 10:124508481-124508503 GTTGCAGGAGCTTCCGGCCCTGG + Intronic
1077445825 11:2590383-2590405 TTCGCAGAAGCCCCCGTCCCAGG + Intronic
1079293393 11:19209489-19209511 TTTTCAGAAGCCCCCCACCCAGG + Intronic
1082820400 11:57541033-57541055 ATTGCTGGAGCCGCTGAACCAGG + Intergenic
1083050623 11:59773204-59773226 TTTGCAGAAGCAGCTGACACAGG + Exonic
1083924217 11:65796258-65796280 TTCGCAGGAGCAGCCGTCCAGGG - Exonic
1084101280 11:66951313-66951335 TCTGCAGGAGCAGCCGAGCCAGG - Intronic
1084658990 11:70536140-70536162 TCTGCTGGAGGCACCGACCCAGG + Intronic
1088834522 11:113566744-113566766 TCTGCTGGAGCCTCCCACCCAGG + Intergenic
1101692125 12:107092824-107092846 ATTGGAGGAGCCGGCGAACCAGG + Exonic
1102638414 12:114344885-114344907 TTTCCAGGGGCCTCAGACCCTGG + Intergenic
1103020601 12:117530981-117531003 GGTGCCGGAGACGCCGACCCGGG - Exonic
1104386160 12:128353438-128353460 TTTCCAGGAGCAGCCGGCCTTGG - Intronic
1104724051 12:131065410-131065432 TCTGCTGGAGCCGCTGACCAAGG + Intronic
1113513530 13:110873497-110873519 TGGGCAGGCGCCCCCGACCCCGG + Intergenic
1118315934 14:64726178-64726200 TTTGCAAAAGCCGGAGACCCAGG + Intronic
1122650884 14:103226432-103226454 TTTGCAGGAACTGAAGACCCCGG + Intergenic
1123989535 15:25673188-25673210 TTTACAGGAGCAGCCCACTCCGG + Intergenic
1132316695 15:100895499-100895521 TTTGCAGGTGCCTCTGATCCTGG + Intronic
1138506219 16:57479569-57479591 ATTGGAGGAGCCGGAGACCCAGG - Exonic
1139550611 16:67670757-67670779 TGTGCAGGATCTGCCGACCTGGG + Intergenic
1143189935 17:5033711-5033733 ATTGCAGGAGCCACCGAGCCAGG - Exonic
1143898708 17:10157008-10157030 TGTGAAGGAGCCACCGACCAAGG - Intronic
1145270072 17:21400184-21400206 TTTGCATGTGCAGCCCACCCAGG - Intronic
1145273169 17:21415280-21415302 GTTGCAGGAGCCGCCCTGCCTGG + Exonic
1145308296 17:21687633-21687655 TTTGCATGTGCAGCCCACCCAGG - Intergenic
1146791355 17:35752551-35752573 ATTGCAGGAGACCCCGACCCGGG + Exonic
1147310948 17:39595940-39595962 TTGGCAGGAGCCCCTGCCCCAGG - Intergenic
1157359189 18:46962982-46963004 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1157360183 18:46968909-46968931 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1157360784 18:47022501-47022523 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1157361773 18:47028416-47028438 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1159956019 18:74519116-74519138 TGTGCAGGAGACGCCAACCTGGG - Intronic
1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG + Intronic
1161282726 19:3454476-3454498 GGTGCAGCAGCCGCCAACCCAGG - Intronic
1165343459 19:35228293-35228315 TCTGCAGGGGCCTCTGACCCAGG + Exonic
1165999672 19:39870804-39870826 TTTGCCTGTGCCCCCGACCCTGG - Intronic
929903917 2:46029564-46029586 GTTGCAGGAGCCACTCACCCTGG - Intronic
930838732 2:55823902-55823924 TTGGCACGAGCCACCGCCCCTGG - Intergenic
936575873 2:113654728-113654750 CTGGCATGAGCCGCCGAGCCCGG + Intergenic
1174402965 20:50285758-50285780 TCTCCAGGAGCTGCTGACCCTGG - Intergenic
1175230061 20:57468102-57468124 TTTCTAGGAGCCGCTGCCCCGGG - Intergenic
1179456095 21:41501329-41501351 TAGGCAGGAGCCGCCGTGCCCGG - Intronic
1180177408 21:46097605-46097627 TCTGCAGGAGCTCCTGACCCGGG + Intergenic
1180948932 22:19712120-19712142 TTTACATGAGGCGCTGACCCAGG + Intergenic
1181513647 22:23399847-23399869 GTTGCAGGCGCCGCCGAAGCCGG + Intergenic
1181576864 22:23800782-23800804 TTTGCAGGAGCCTGCTCCCCAGG - Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
950040890 3:9918367-9918389 TTTGGAGGAGCAGCTGACTCAGG + Exonic
950316196 3:12004216-12004238 CTTGCAGGAGGGGGCGACCCAGG - Intergenic
950634936 3:14307967-14307989 TTCGAAGGAGTCGCCCACCCCGG + Intergenic
956462437 3:69485386-69485408 TAGGCAGGAGCCCCCCACCCTGG - Intronic
956781381 3:72606047-72606069 TTTGCAGGAGCCTGGGCCCCTGG - Intergenic
966615974 3:181912737-181912759 TTTTAAGAAGCAGCCGACCCAGG - Intergenic
995324333 5:110873325-110873347 TTTGCAGGAGCTGCCAAAGCTGG + Intergenic
1003139099 6:3456562-3456584 TCTGCGGGAGCCGCGGGCCCGGG - Intronic
1007161150 6:39792629-39792651 TTTGCAGGAGCCGCCGACCCCGG + Intronic
1031301035 7:120060888-120060910 TTTGCATGAGCCCCAAACCCGGG + Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG + Intergenic
1049586312 8:143434177-143434199 TTAGCAGGAGCCCCCGTCCAGGG + Intergenic
1057196116 9:93116309-93116331 TATGGAGGAGCCACCGGCCCCGG - Intergenic
1057315782 9:93967382-93967404 TGTGCAGGTGAGGCCGACCCAGG + Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1061251039 9:129426541-129426563 TAGGCATGAGCCGCCGAGCCTGG - Intergenic
1186471561 X:9826022-9826044 TTTGCAGGAGGCGGAGGCCCAGG - Intronic
1191059915 X:56284334-56284356 TTTCCAGGAGCAGCCATCCCAGG - Exonic
1195424460 X:104712784-104712806 TTTGTAGCAGCCCCTGACCCAGG + Intronic