ID: 1007162458

View in Genome Browser
Species Human (GRCh38)
Location 6:39802818-39802840
Sequence GGTGGTGGATGTTCAGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007162458_1007162468 16 Left 1007162458 6:39802818-39802840 CCATAAACTGAACATCCACCACC 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1007162468 6:39802857-39802879 AGCCCCCTCGTGCCCCTCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007162458 Original CRISPR GGTGGTGGATGTTCAGTTTA TGG (reversed) Intronic
902362267 1:15948387-15948409 GGTGGACGGTGTTCACTTTAAGG - Exonic
903056545 1:20640115-20640137 GGTGATGGATTTTCAGTTAGTGG + Intronic
905856847 1:41320053-41320075 GGTGGTGCTTGTTCTATTTAGGG - Intergenic
906641433 1:47443206-47443228 TAGGGTGGGTGTTCAGTTTAAGG + Intergenic
908236799 1:62155023-62155045 GGAGAAGGATGGTCAGTTTATGG - Intronic
909768920 1:79395190-79395212 GGTGGGGGATGTTAAGAATATGG + Intergenic
911624792 1:100110405-100110427 GCTGGTGGATGTTTTGTTGATGG + Exonic
911686055 1:100779099-100779121 GGTGGTGAATGGTCAGTAAAAGG - Intergenic
913692878 1:121296132-121296154 GGTTTTGGATTTTAAGTTTAAGG + Intronic
914144678 1:144983946-144983968 GGTTTTGGATTTTAAGTTTAAGG - Intronic
917455856 1:175185054-175185076 GGTTTTGGATTTTCAGATTAGGG - Intronic
918613154 1:186514548-186514570 TGTGGGGGATGGTCAATTTAGGG - Intergenic
920480199 1:206314504-206314526 GGTTTTGGATTTTAAGTTTAAGG + Intronic
920724065 1:208417197-208417219 GGTCGTGGATGTTCATTTAGTGG - Intergenic
920739400 1:208566037-208566059 GGTGGTAGATTTGCAGTTTCTGG + Intergenic
922585091 1:226728012-226728034 GGTGGTGAATTTTCAGCTGAAGG - Intronic
922866993 1:228868757-228868779 GGTGGTGGGTATCCATTTTAGGG + Intergenic
1062827188 10:581145-581167 GGTGGGGGATGTCCACTTTGTGG - Intronic
1063065699 10:2606242-2606264 AGTGGGAGATGTTCAGGTTATGG + Intergenic
1064433245 10:15289426-15289448 GGTGATGGATGTGCAGGGTATGG - Intronic
1064994787 10:21287078-21287100 GGTTGTGGATTTTCAGCTTCTGG - Intergenic
1070441012 10:76443327-76443349 GGTAGTGGATGATCAGTCAATGG - Intronic
1075960269 10:126562339-126562361 GGTTGTGGATGTCCACTCTAGGG - Intronic
1078492163 11:11779496-11779518 GGCAGTGAATGTTCAGTGTAAGG + Intergenic
1081521488 11:43886074-43886096 GCTGGAGGATGATGAGTTTATGG + Intronic
1084466330 11:69325110-69325132 GGTGGTGGATGTGCGGGTGATGG + Intronic
1087798629 11:102480539-102480561 GGATGTGGATGTTAATTTTAAGG - Intronic
1088450475 11:109976631-109976653 GGCAGTGGATATTCAGGTTAAGG + Intergenic
1096628532 12:52910481-52910503 GGTGGTGGAGTTTCAGGTTCTGG - Intronic
1099144785 12:79027858-79027880 GGTGGTTGATGTGAAGTCTATGG - Intronic
1103440466 12:120959069-120959091 GGTGGTGGATGTATAGTTGGCGG + Intergenic
1103577341 12:121888178-121888200 GGTGCTGGATGTTCCTGTTAAGG - Intergenic
1103881578 12:124170193-124170215 TGTGGAGGATGGTCAGTGTAGGG - Intronic
1104071258 12:125347700-125347722 AGTGGTGGAGGTTCATTTTAGGG + Intronic
1105242863 13:18622967-18622989 GGTGGTGGTTGTTCAGCAAAGGG + Intergenic
1106641838 13:31592802-31592824 GGAGGTGGATGTTTGGGTTAAGG - Intergenic
1108313534 13:49218018-49218040 GGTGGTGGGTGTTGGGTCTAAGG + Intergenic
1110945099 13:81403955-81403977 GTTAGTGGATGTTCACTATAAGG + Intergenic
1115746626 14:36444463-36444485 GGTTTTGGATTTTCAGATTAAGG + Intergenic
1119475908 14:74928205-74928227 GGTTTTGGATTTTCAGATTAGGG + Intergenic
1120668779 14:87339687-87339709 CGTGCTGGATGTTCATATTATGG + Intergenic
1123544930 15:21330710-21330732 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1202953279 15_KI270727v1_random:57981-58003 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1134760001 16:16705886-16705908 GGTAGTGGATGTTCTGTTTCAGG + Intergenic
1134986070 16:18653319-18653341 GGTAGTGGATGTTCTGTTTCAGG - Intergenic
1137708351 16:50549790-50549812 GGTGGTGAAGGTCCAGTTGATGG + Intronic
1139042670 16:63016868-63016890 GGTAGTGGATGTTCTGTCCAGGG - Intergenic
1141263629 16:82475962-82475984 GAGGGTGGTTGTTCAGATTAGGG - Intergenic
1143149777 17:4800662-4800684 GGTGGTGATTCTTCAGTTTCAGG - Intergenic
1145288562 17:21524231-21524253 AGGGGTGGATGTTCAGCTCAGGG - Intergenic
1145389100 17:22442198-22442220 GGGGGTGGATATTCAGCTCAGGG + Intergenic
1149678967 17:58491028-58491050 ATTGGTGAATATTCAGTTTAGGG - Exonic
1150217931 17:63480587-63480609 GGTGGGGGATGTCCAGGGTAAGG + Intergenic
1154446071 18:14436910-14436932 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1155499330 18:26471340-26471362 GGCGGTGGAGGTTCAGTACATGG - Intronic
1159282049 18:66298227-66298249 GGTGGTGGTTGTTGAATTTTAGG + Intergenic
1160319286 18:77875180-77875202 GATGGTGGATGGTCAGTTCTTGG - Intergenic
1165472983 19:36014163-36014185 GCTGGTGGACGGTCAGTTTTGGG - Exonic
926795134 2:16612759-16612781 GGAGGTGGATGCTCATTTTATGG + Intronic
929277161 2:40038531-40038553 GGTCCTCGATGTTCAGTTGAAGG - Intergenic
929969355 2:46560458-46560480 AGTGGTGGATATTCTGTTCAGGG + Intronic
930530641 2:52584189-52584211 GCTGGTGAATGTGCAGTATAGGG - Intergenic
932391842 2:71398439-71398461 GATTTTGGATTTTCAGTTTAGGG + Intronic
937120880 2:119439348-119439370 GGTGGCGGAAGTTCAGTCCAGGG - Intergenic
940321389 2:152380887-152380909 GTTTATGGCTGTTCAGTTTATGG + Intronic
943498313 2:188652609-188652631 GGTGGTGGCTGTTCAGCTTATGG + Intergenic
945010856 2:205461822-205461844 GGTGGTGAATCATTAGTTTAAGG + Intronic
945748605 2:213751326-213751348 TGTGGGGTATGTTGAGTTTAGGG - Intronic
1169080859 20:2797094-2797116 TCTGGTGGAGGTTGAGTTTATGG + Exonic
1171373394 20:24675916-24675938 GGCAGTGGGTGTTCAGTATATGG + Intergenic
1179466534 21:41579398-41579420 GTTTGAGGATGTTCAGGTTATGG - Intergenic
1181825489 22:25512068-25512090 GGTGGGGAATGTTCTGCTTATGG + Intergenic
1182625748 22:31644731-31644753 GATTTTGGATGTTCAGATTAGGG - Intronic
1182808700 22:33097444-33097466 GGTGTTGGATGTGCACCTTACGG - Intergenic
1184290812 22:43497161-43497183 GGTGGTGGAAGTGCTGTTGATGG + Intronic
950710259 3:14809065-14809087 GGTGGTGGAGGTGGAGTTGAAGG - Intergenic
953121794 3:40051261-40051283 GGTGGTGGATGCTGAGGTTTGGG - Intronic
955733057 3:62007835-62007857 GGTGGTGTTTGTTAAGTTTAAGG + Intronic
956834850 3:73088491-73088513 GGTGGGAGCTCTTCAGTTTAAGG + Intergenic
957927992 3:86839925-86839947 AGTGGTGGGTGTTCGGGTTATGG + Intergenic
957958843 3:87224436-87224458 GGTGGTGGCTGTTAAGGTGAAGG + Intergenic
959007877 3:101040916-101040938 GGTTTTGGATTTTCAGATTAAGG + Intergenic
960236218 3:115285589-115285611 GGTGGATTATGTTCAGTTTTGGG + Intergenic
964397849 3:156266049-156266071 GGAGGTGGTTGGTCAGTTTTGGG - Intronic
965801428 3:172497697-172497719 GGTGGTGGAGGGTCAATTTCAGG + Intergenic
967127616 3:186438330-186438352 TGCGGTGGATGTTAAGGTTATGG - Intergenic
972304355 4:37817707-37817729 GGTGGTGTACTTTGAGTTTATGG + Intergenic
973549198 4:52014800-52014822 GACGGTGGAAGTTCAGTGTAAGG - Intronic
977070474 4:92378388-92378410 AGTGCTGGATTTACAGTTTAAGG + Intronic
977447813 4:97153648-97153670 TGTGATAGATGTTCATTTTATGG + Intergenic
978026717 4:103885574-103885596 GGTGGTGGATGTTTACTAAACGG + Intergenic
979752878 4:124301119-124301141 GGTGTGGGTTCTTCAGTTTAAGG + Intergenic
981635696 4:146876609-146876631 GGTGGTGGATAATCAGTAAACGG + Intronic
983925776 4:173400424-173400446 GTTGGTGAACGTTGAGTTTAAGG + Intronic
985005491 4:185531307-185531329 AGTTTTGGATGTTCAGTTTAGGG - Intronic
988478523 5:31609783-31609805 TTTGGTGTATGTTCAGTCTAAGG + Intergenic
991140202 5:63231733-63231755 GGAGGTAGAGGTTCAATTTAAGG + Intergenic
991508695 5:67352898-67352920 GGTGGGAAATGTTCTGTTTAAGG + Intergenic
992656549 5:78915932-78915954 GATGGTGGATTTTCAGGTTAGGG + Intronic
993373110 5:87116937-87116959 ATTGGTGGATGTTTTGTTTAGGG - Intergenic
994732487 5:103509159-103509181 GGTGATGGATGTGCAGTCTCAGG + Intergenic
998427257 5:142039475-142039497 CGTGGTGAATGGTCAGTATATGG + Intergenic
998506383 5:142675607-142675629 GGTGGTGGAGGTTAAATTCAAGG - Intronic
998524199 5:142827481-142827503 GGTGGTGGAGGTTGAGGTTGGGG + Intronic
999706011 5:154272965-154272987 GGAGGTGGATCTGCAGTTTCTGG + Intronic
1003123790 6:3339237-3339259 GGTGGTGGATTATCAGATTGGGG - Intronic
1004688633 6:17972711-17972733 TGTGGTGGGTGTGCAGTCTAGGG + Intronic
1005577678 6:27205314-27205336 GGTGGTGGGTGGTCAGTGGATGG - Intergenic
1006289875 6:33126489-33126511 TCTGATGGATGTTGAGTTTATGG + Intergenic
1006708156 6:36040101-36040123 GGTTTTGGATTTTCAGATTAGGG + Intronic
1007162458 6:39802818-39802840 GGTGGTGGATGTTCAGTTTATGG - Intronic
1009893638 6:69720626-69720648 GATGTTGGATTTTCAGATTAGGG - Intronic
1010087545 6:71938266-71938288 GGTGGTGGATGTACTGTTCTAGG + Intronic
1011499375 6:87970913-87970935 TGTGGGTGATGTCCAGTTTAAGG + Intergenic
1015462021 6:133502320-133502342 TGTAGTGAATGTTGAGTTTAGGG - Intronic
1016220234 6:141659997-141660019 GGTGGTGGTTGCTGAGTTTGGGG + Intergenic
1016244065 6:141962312-141962334 GGTGGACTATGTTCAGTTTTGGG - Intergenic
1017295986 6:152795339-152795361 GGAAGTGGATGTGGAGTTTAAGG + Intergenic
1017416341 6:154225145-154225167 GGTGTTGGATTTTCAGATTTGGG - Intronic
1018693138 6:166365679-166365701 GATTTTGGATTTTCAGTTTAGGG - Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1026733188 7:72929133-72929155 GGTGGTGGATGTTGGGGTTTTGG + Intronic
1028050419 7:86178058-86178080 AGTGGTGGATGTTCCGGCTAGGG + Intergenic
1035550038 8:515474-515496 GATTTTGGATTTTCAGTTTAGGG - Intronic
1037288085 8:17322223-17322245 CCTGGTGGATGTTCAGTGGAGGG - Intronic
1039400015 8:37261526-37261548 GGTGGTGCTGGTTCAGTTTTTGG - Intergenic
1039808490 8:41023947-41023969 AGTGGTGGCTGTTCAGGTCATGG + Intergenic
1045568699 8:103347845-103347867 GGTGGTGGATGTTGACAGTAGGG - Intergenic
1046359490 8:113131730-113131752 GTTGGTGGATCTACAGTTTTAGG - Intronic
1049925201 9:400920-400942 GGTGGTGGATGTTGTGGTGATGG - Intronic
1051242849 9:15078608-15078630 GATTGTGTATGTCCAGTTTATGG - Intergenic
1052924291 9:34001905-34001927 GGTGTTAGATGGTCACTTTATGG - Intronic
1057593541 9:96394796-96394818 GGTGTTAGAAGTTAAGTTTATGG - Intronic
1057684607 9:97221351-97221373 GGTGGTGGATCTTGGATTTAGGG - Intergenic
1061845151 9:133383745-133383767 GGTGGTGGCTGTGCAGATGATGG + Intronic
1203519275 Un_GL000213v1:31575-31597 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1185881058 X:3741224-3741246 GGTGATGCATGTTCAGGGTAGGG + Intergenic
1186615658 X:11184882-11184904 GGTGGTGTATGTACACTCTATGG - Intronic
1187074287 X:15918397-15918419 GGTGGTGGTGGTTTAGTTTTGGG + Intergenic
1190427485 X:50346435-50346457 GGTGGTGGTGGTACAGTTTTGGG + Intronic
1190451456 X:50585373-50585395 GGTGGTGGATTTTCAGGTAGAGG + Intergenic
1194283787 X:91984976-91984998 GGTGGCGGGTGTGCAGGTTATGG - Intronic
1197474230 X:126900932-126900954 GGTGGTCGATGTTCAGGTTGAGG - Intergenic
1199541562 X:148963717-148963739 GGTGGTGGATGTAATGTTTCAGG + Intronic
1200601358 Y:5209540-5209562 GGTGGCGGGTGTGCAGGTTATGG - Intronic
1200783988 Y:7242921-7242943 GGTGATGCATGTTCAGGGTAGGG - Intergenic