ID: 1007163263

View in Genome Browser
Species Human (GRCh38)
Location 6:39810105-39810127
Sequence ATAAGCTTCTCGGAAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007163260_1007163263 -1 Left 1007163260 6:39810083-39810105 CCAGCTACTTCCAGTCTCTTTAA 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1007163263 6:39810105-39810127 ATAAGCTTCTCGGAAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007163263 Original CRISPR ATAAGCTTCTCGGAAAGTCC TGG Intronic
No off target data available for this crispr