ID: 1007165505

View in Genome Browser
Species Human (GRCh38)
Location 6:39825989-39826011
Sequence TCCCCATGGTGCAGGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007165505 Original CRISPR TCCCCATGGTGCAGGTGTGT TGG Intronic
900639146 1:3680600-3680622 GCCTCTTGGTGCAGGTATGTGGG - Intronic
901442268 1:9285628-9285650 ACCCCATGGTGAAGGTGGGCAGG + Intergenic
903847487 1:26287133-26287155 TCCTGATGGTGCAGATGGGTGGG - Intronic
904370665 1:30045637-30045659 TGCCCTTGATGCAGGTGTGTTGG - Intergenic
904428268 1:30445714-30445736 TCCCGTCGCTGCAGGTGTGTGGG + Intergenic
904856265 1:33500249-33500271 ACCCCATGCTGCAGCTGAGTGGG + Intergenic
904868467 1:33601277-33601299 GCTCCATGGAGCAGGGGTGTGGG + Intronic
906242305 1:44249493-44249515 TACCCATGGGGCTGGAGTGTTGG - Intronic
906545814 1:46618701-46618723 ACCCCAGGCTGCAGGAGTGTGGG + Intergenic
907525625 1:55052453-55052475 TCCCCATCCTGGAGGTGGGTGGG + Intronic
909776974 1:79493772-79493794 TCCCCTGGGTGCAGGTGTGCTGG + Intergenic
910934949 1:92480183-92480205 TTGCCCTGGTGCAGGTGTGTAGG - Intronic
912448266 1:109753389-109753411 ATCCCACGGTGCAGGTGTCTGGG + Intronic
913960159 1:143333298-143333320 TCCTCAAGGTTCATGTGTGTTGG - Intergenic
913975593 1:143452078-143452100 TCACCATGCTGCAGGTGTCTGGG - Intergenic
914054515 1:144158871-144158893 TCCTCAAGGTTCATGTGTGTTGG - Intergenic
914069988 1:144277695-144277717 TCACCATGCTGCAGGTGTCTGGG - Intergenic
914109167 1:144688659-144688681 TCACCATGCTGCAGGTGTCTGGG + Intergenic
914124631 1:144807490-144807512 TCCTCAAGGTTCATGTGTGTTGG + Intergenic
914854599 1:151342172-151342194 CCCCCATGATACAGGTCTGTGGG - Exonic
914884102 1:151570992-151571014 TGCCCATGGGCCAGGTGTGGTGG - Intronic
915519246 1:156431601-156431623 ACCCCAAGGTGCAGGATTGTAGG + Intergenic
917181519 1:172302764-172302786 TCCCTCAGGTGCAGGTCTGTTGG - Intronic
919776959 1:201200450-201200472 CACCTATGGTCCAGGTGTGTGGG - Intronic
919810496 1:201406026-201406048 CCCCTTTGGTGCGGGTGTGTGGG + Exonic
920256943 1:204661912-204661934 TGCCCAGGGTGCAGGGGTGCAGG - Intronic
920345140 1:205301535-205301557 TCTCAATGGAGCAGGCGTGTGGG + Intergenic
920631911 1:207660415-207660437 TCCCTCAGCTGCAGGTGTGTTGG - Intronic
922620358 1:226984816-226984838 GCTCCATGGTGCGGGTGTGTGGG - Intronic
923416657 1:233769414-233769436 TCCCTCAGGTGCAGGTCTGTTGG + Intergenic
924528716 1:244875158-244875180 CTCCCATGGTGTAGGTTTGTAGG + Intergenic
1063146198 10:3297204-3297226 TCCCCATGGTGCTGCTCTGATGG + Intergenic
1067370117 10:45674867-45674889 TCACCATGGTGCAGTCTTGTAGG - Intergenic
1067945640 10:50686574-50686596 TCCCATTGGTGATGGTGTGTTGG - Intergenic
1068116778 10:52744692-52744714 TCACCCTGGGGCAGGAGTGTGGG + Intergenic
1070867153 10:79713447-79713469 TCCCATTGGTGATGGTGTGTTGG - Intronic
1071499055 10:86190576-86190598 TCCCCATCCTGCAGGTGTGCAGG + Intronic
1071634068 10:87235671-87235693 TCCCATTGGTGATGGTGTGTTGG - Intronic
1071647514 10:87367888-87367910 TCCCATTGGTGATGGTGTGTTGG - Intronic
1072379928 10:94857776-94857798 TCCCTAAGCTGCAGGTCTGTTGG + Intergenic
1072997245 10:100256281-100256303 TCCCCATGGCCCAAGTGTGTGGG - Exonic
1074017366 10:109547175-109547197 TCCCTCTGCTGCAGGTCTGTTGG - Intergenic
1074310457 10:112317950-112317972 TGGCCATGGTGAGGGTGTGTTGG - Intergenic
1077477298 11:2796553-2796575 TCCCCATGGAGAGGGTGTGTCGG - Intronic
1077489365 11:2853334-2853356 GCCCCAAGGTGCAGGGGTGGGGG + Intergenic
1078119399 11:8490825-8490847 TCCCTTAGCTGCAGGTGTGTTGG - Intronic
1078283907 11:9931514-9931536 TCCCTCAGCTGCAGGTGTGTTGG - Intronic
1078358871 11:10652975-10652997 TCCCCATGGTGCAGCAGCCTGGG + Intronic
1079388066 11:19998318-19998340 TGGCCATGGTGCAGGGGTCTAGG + Intronic
1081670538 11:44939864-44939886 TCACCATGGGGCCTGTGTGTGGG - Intronic
1082568850 11:54713787-54713809 TCCCTCAGCTGCAGGTGTGTTGG + Intergenic
1083330730 11:61897259-61897281 GCCCCAGGGTGCAGGAGTGAGGG + Intergenic
1086475644 11:87170542-87170564 CCCCTATGCTGCAGGTCTGTTGG + Intronic
1087332000 11:96792779-96792801 TCCCTCAGCTGCAGGTGTGTTGG + Intergenic
1089453767 11:118613883-118613905 AGACCATGGTGCAGGTGAGTGGG + Exonic
1092045015 12:5425551-5425573 TCCCCTGGGGGCAGGTGTATAGG + Intergenic
1093369391 12:18348976-18348998 TCCCCATGGTGTATAGGTGTGGG + Intronic
1097167796 12:57094839-57094861 TGCCCATGGAGCAGGTGGGGAGG - Exonic
1098019800 12:66142341-66142363 ACCCCATGGTGCAGGAACGTTGG - Intronic
1098993817 12:77095704-77095726 TCCCTCAGCTGCAGGTGTGTTGG + Intergenic
1099269208 12:80486397-80486419 TCCCCATGTAGCTGGTGTTTGGG + Intronic
1102451933 12:113048450-113048472 TCCCCATGTTGTAGCTGTGTCGG - Intergenic
1102785859 12:115604359-115604381 TCCTCATGGAGCAGGTGGGGAGG - Intergenic
1102951865 12:117036579-117036601 TCTCCAGGGGGCAGGGGTGTGGG + Intergenic
1103710899 12:122911947-122911969 TCCCTATGGACCATGTGTGTTGG + Intergenic
1103988165 12:124780871-124780893 TTCCCAGGGTGCAGGGGTGGGGG - Intronic
1104204357 12:126622976-126622998 TTCCCATGGGGTAGGTGTGCAGG - Intergenic
1104419272 12:128621722-128621744 TCCCAGTGGGACAGGTGTGTGGG - Intronic
1105866184 13:24461686-24461708 TCTCCGTGGAGCAGGTGTGTGGG + Intronic
1108256855 13:48619307-48619329 TCCCCATACTGCACATGTGTCGG - Intergenic
1113457807 13:110461406-110461428 GCCCAATGGTGCAGATGTGCAGG - Intronic
1113800841 13:113085614-113085636 TCCCCAGGGAGCAGGTGCGAGGG + Intronic
1113841415 13:113363715-113363737 TCCCGAGGGCGCAGGTGGGTTGG - Intronic
1119453472 14:74733409-74733431 ACCCCATGGGGCGGGTGGGTGGG + Intronic
1122443271 14:101749459-101749481 TCCCTCAGGTGCAGGTCTGTTGG + Intergenic
1124383860 15:29190156-29190178 GACCGATGGTGCAGGTGTGAAGG - Intronic
1129680638 15:77656677-77656699 TCCCCAGGATGCAGATATGTGGG + Intronic
1132500084 16:281206-281228 TCCCCATGGTGCTCGGGTGCCGG - Intronic
1133348951 16:5088983-5089005 CCCCCATGGTGTGGGAGTGTGGG + Intronic
1135762982 16:25152385-25152407 TCCCCTTGGTTCAGGTGGCTGGG + Intronic
1137445527 16:48529611-48529633 TCCCCATGGTGGAGGGGAGGGGG - Intergenic
1137890876 16:52161028-52161050 TCCCTCAGCTGCAGGTGTGTTGG + Intergenic
1139472394 16:67185127-67185149 ACCCCACGGTTCAGGTGGGTTGG - Exonic
1141962313 16:87417451-87417473 TCTCCATGGAGAAGGTATGTCGG - Exonic
1146275132 17:31511682-31511704 TCCCCATGGGGGAGGTGGGGAGG + Intronic
1147594645 17:41709048-41709070 CCTCGAGGGTGCAGGTGTGTGGG - Intergenic
1149475737 17:56959754-56959776 TGCCCATGGTGCAGATGTGCCGG - Intronic
1150109157 17:62482845-62482867 TCCCCATACTGCAGATGTGGAGG - Intronic
1150609739 17:66724344-66724366 TCCTCCTGGTGCAGGGGTGGAGG + Intronic
1152016389 17:77753688-77753710 ACCCCATTGAGGAGGTGTGTGGG + Intergenic
1152291964 17:79445044-79445066 TCCTCAAGGTTCATGTGTGTTGG + Intronic
1152962355 18:87381-87403 GCCCCATCCTGCAGGGGTGTCGG + Intergenic
1153559788 18:6360622-6360644 TCCCCAATGTGCATGTGTATGGG + Intronic
1153736792 18:8078930-8078952 TCCCAATGTTGGAGGTGTTTGGG - Intronic
1156465187 18:37344238-37344260 ACCCCATGGGGCAGGTCAGTGGG - Intronic
1157561545 18:48649862-48649884 TCCCTCAGGTGCAGGTCTGTTGG - Intronic
1160708052 19:539048-539070 TCCACATGGCACATGTGTGTTGG - Intronic
1160817734 19:1043828-1043850 TGGCCATGCTGCAGGTGTGCGGG + Exonic
1161160467 19:2758830-2758852 TCCTCAAGGTGCATGTGTGCTGG - Intronic
1162459846 19:10808215-10808237 TCCCCATTGGGCAGGGGTGGGGG + Intronic
1162500071 19:11048092-11048114 TCAGCCTGGTGCAGCTGTGTGGG - Intronic
1162728828 19:12705673-12705695 TCCCCCTGCTGGAGGTGAGTGGG - Exonic
1163302564 19:16457230-16457252 ACACCTTGGTGCAGGTGTGGAGG + Intronic
1163580280 19:18134803-18134825 TCTCCCTGGCCCAGGTGTGTGGG + Exonic
1164450707 19:28361715-28361737 CCCTCATTGTGCAGATGTGTTGG - Intergenic
1167133917 19:47605710-47605732 CCTCCATGGCCCAGGTGTGTAGG - Intergenic
1202693994 1_KI270712v1_random:111549-111571 TCCTCAAGGTTCATGTGTGTTGG - Intergenic
926209159 2:10856207-10856229 GCCCCATGGTGGAGGTGGGGTGG + Intergenic
926710814 2:15878867-15878889 TCACTAAGGAGCAGGTGTGTTGG - Intergenic
928750758 2:34467395-34467417 TCCCCGTGTTGCAGGTCTGCTGG - Intergenic
931033871 2:58214798-58214820 TCCTCATGGGCCAGGTGTGGTGG - Intronic
932361338 2:71109443-71109465 TCCTCAGGGTCCAGGTGTTTTGG - Intergenic
933777514 2:85779910-85779932 TGCTCGTGGTGGAGGTGTGTGGG + Intronic
934180293 2:89613050-89613072 TCACCATGCTGCAGGTGTCTGGG - Intergenic
934208764 2:89956666-89956688 TCCCCATTGTGCTGCTGTATTGG + Intergenic
934290592 2:91687313-91687335 TCACCATGCTGCAGGTGTCTGGG - Intergenic
935399534 2:102645185-102645207 TCCCTCTGCTGCAGGTCTGTTGG - Intronic
940995912 2:160149340-160149362 TCCCTCAGCTGCAGGTGTGTTGG - Intronic
941151475 2:161919788-161919810 TCACCATGTTGCAGGTGAGGAGG + Intronic
941725795 2:168858773-168858795 TTCCCATGCTGGAGGTGTGGGGG + Intronic
941880834 2:170478490-170478512 TGGCCATGGAGAAGGTGTGTGGG + Intronic
943716859 2:191161453-191161475 TCCCTCAGGTGCAGGTCTGTTGG - Intergenic
944906776 2:204269688-204269710 TCCACATGGAGCAGGTAGGTGGG + Intergenic
946394533 2:219436504-219436526 TCCCCTGGGTGCTGCTGTGTAGG + Intronic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169259196 20:4123042-4123064 TTCCTATGGTGCAGGTCTGGGGG - Intronic
1171148861 20:22809520-22809542 TCTCCAGGCTGCAGGTGGGTGGG - Intergenic
1172439281 20:34954265-34954287 TCACCATGGGCCAGGTGTGGTGG + Intronic
1172608482 20:36231713-36231735 TCCCCCTGGTGCAGGCCGGTGGG + Exonic
1175698281 20:61118799-61118821 CTCCCTTGTTGCAGGTGTGTAGG - Intergenic
1179097461 21:38328417-38328439 TTCCCATGGACCAGGGGTGTGGG + Intergenic
1179464285 21:41561468-41561490 ATCCAATGGTGCAGGTGTGCTGG - Intergenic
1179563740 21:42233753-42233775 TCCGCAGGGTGCAGGTCAGTGGG + Intronic
1181000602 22:19986289-19986311 TGCCCAGGTAGCAGGTGTGTGGG + Intronic
1181018728 22:20086963-20086985 TGCCCCTGGACCAGGTGTGTTGG + Intronic
1181349510 22:22245010-22245032 TCCTCAGGGTGCAGGTGAGGCGG - Exonic
1182548117 22:31087144-31087166 TCTACATGGTGGAGGTGTGGGGG + Intronic
1183659023 22:39207443-39207465 TGGCCAAGGGGCAGGTGTGTGGG + Intergenic
1184139434 22:42569892-42569914 TCACAATGGTGCAGGAGTATCGG + Intronic
1184370125 22:44076799-44076821 TCCCTAGGGTGCAGGGGAGTTGG - Intronic
1184870204 22:47232983-47233005 TCCCCAGGATGCAGCTGGGTTGG - Intergenic
1185116415 22:48940750-48940772 TCCCCATGGTGCAGTTTTTCAGG + Intergenic
949365471 3:3275948-3275970 TCTCCAAGGTCCAGATGTGTAGG - Intergenic
951178656 3:19632665-19632687 CTCCCATGGTGCTGGTGTGTTGG + Intergenic
951209700 3:19961955-19961977 TCTCCATGGTTCTGGTGAGTGGG + Intronic
951217508 3:20039837-20039859 TCCCACTGGTGCAGGCGTGCGGG + Intergenic
952525769 3:34208928-34208950 TGCCCATTCAGCAGGTGTGTGGG + Intergenic
952855065 3:37763448-37763470 CCCCCATGCTGCCGTTGTGTGGG + Intronic
953782557 3:45884499-45884521 TCCCCGTGGTCCAGGTGAGGTGG - Intronic
954513776 3:51152751-51152773 TCCCTCTGCTGCAGGTCTGTTGG + Intronic
955873220 3:63461822-63461844 TACCCATCTTGCAGGTATGTTGG + Intronic
956373165 3:68586393-68586415 TCCCTCTGCTGCAGGTCTGTTGG + Intergenic
958537132 3:95418364-95418386 ACCCCCTGGTGCATGTGTGTGGG - Intergenic
958835678 3:99141841-99141863 TCCCAATGGTGAATTTGTGTTGG - Intergenic
961569051 3:127785201-127785223 TCCACCTGCAGCAGGTGTGTGGG - Intronic
969597049 4:8155440-8155462 CCCCCTTTGTGCAGGTGGGTGGG + Intronic
969828988 4:9780587-9780609 TCACCATGCTGCAGGTGTCTGGG + Intronic
969937714 4:10698843-10698865 TCTCCCTGCTGCAGGTGGGTAGG + Intergenic
970006770 4:11418651-11418673 TTCCCATGGTGCAGGCAGGTGGG + Intronic
971473701 4:27052906-27052928 TCCCAATTGTGCAGTTGGGTTGG + Intergenic
971697987 4:29930525-29930547 TCCCTCTGCTGCAGGTCTGTTGG - Intergenic
972925281 4:43998115-43998137 TCCCCATAGTGAAGGTGATTGGG - Intergenic
973805970 4:54526568-54526590 TCTCCAAGGTGCAGGTGAGGAGG - Intergenic
975364890 4:73518086-73518108 TCCCTCAGGTGCAGGTCTGTTGG + Intergenic
975559582 4:75696472-75696494 TCCACATGGTGAAGGACTGTTGG - Intronic
977119091 4:93074008-93074030 TCCACTTGGTGCAGCTGTGAAGG + Intronic
977380784 4:96271136-96271158 TTCCCAGAGTGCAGGTGTATAGG + Intergenic
978134239 4:105237330-105237352 TTCCCATCTTGCAGATGTGTAGG + Exonic
983413408 4:167425338-167425360 ACCGCAGGGTGCATGTGTGTTGG - Intergenic
983467913 4:168117946-168117968 TCCCCATGGTCCCAGTGTGAGGG - Intronic
983933536 4:173478597-173478619 TTCCCAGGGTGAAGGGGTGTGGG - Intergenic
985808943 5:2069055-2069077 TCCCCCTGCTGCAGGGGTGCAGG + Intergenic
986308175 5:6531094-6531116 GCCCCATGGAGCAGGAGTGAAGG - Intergenic
987900471 5:24004142-24004164 TCCCTGTGGTGCAGGGGTCTTGG - Intronic
988975268 5:36508913-36508935 TCCCTCAGGTGCAGGTGTGTTGG - Intergenic
990983232 5:61619953-61619975 TCCCCATGGACCAAGTATGTGGG - Intergenic
991364212 5:65852164-65852186 CCCCCCGGGTGCAGGTCTGTTGG + Intronic
991387596 5:66106815-66106837 TCCCTCTGCTGCAGGTCTGTTGG - Intergenic
995045601 5:107643216-107643238 CCCCCATTGTGCAGGGGTGGGGG + Intronic
995361093 5:111298556-111298578 TCCCCGTTATGCAGGTGTCTGGG - Intronic
995564150 5:113416025-113416047 TCCCTAAGCTGCAGGTCTGTTGG + Intronic
998127798 5:139636003-139636025 TCCCAGTGGTGCATGTGTGTGGG - Intergenic
1002054392 5:176590342-176590364 TGCCCTTGGGGCAGGTGTGAGGG + Intronic
1002058896 5:176614674-176614696 TTCAGAGGGTGCAGGTGTGTGGG - Intergenic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002542837 5:179917515-179917537 TCCGCCTGCTGCAGGTGTGATGG - Intronic
1003509480 6:6767615-6767637 TCCCAATGTTGGAGGTGGGTGGG - Intergenic
1003516805 6:6824861-6824883 TCCCGCTGTTGCAGGTGTGGAGG + Intergenic
1003854266 6:10256298-10256320 TCCCCCTGGTGGAGGCGTGAGGG - Intergenic
1004016166 6:11733782-11733804 TCCCCATGATGCAGGTAATTAGG - Intronic
1004879663 6:19995369-19995391 TCCCCATGGTGCAGGGGCCATGG + Intergenic
1005222387 6:23601543-23601565 TCCCCACTGTGAAGGTGAGTTGG - Intergenic
1005945222 6:30590399-30590421 TCCCCATGGAGCAGGGATGAGGG - Intronic
1007165505 6:39825989-39826011 TCCCCATGGTGCAGGTGTGTTGG + Intronic
1007555022 6:42758494-42758516 GCCAGATGGTGCAGGTGTATTGG + Intronic
1009988043 6:70805758-70805780 TCCCTCTGCTGCAGGTCTGTTGG + Intronic
1012808194 6:103922532-103922554 TTTCTATGGTGCAGGTGTGTAGG + Intergenic
1014504235 6:122232882-122232904 GCTCCATGGTGCAGGTGTAGAGG + Intergenic
1015046200 6:128779478-128779500 TCCCTCTGCTGCAGGTCTGTTGG + Intergenic
1016269667 6:142273876-142273898 TCCCCATTGTACAGATGAGTAGG - Intergenic
1016312921 6:142753749-142753771 TCCCCATGGTGCCCGTTGGTGGG - Exonic
1016792124 6:148077073-148077095 TCCCCAAAGTGGAGGTGTGCAGG - Intergenic
1018174074 6:161164042-161164064 TCCCTATGCTGCAGGTGGGATGG + Intronic
1018372294 6:163179295-163179317 TCAGCAAGGTGCAGGTGTGGTGG - Intronic
1019613445 7:1948274-1948296 GGCCCATGGCGCAGGTGGGTGGG - Intronic
1020475856 7:8593506-8593528 TCCCCATGGTTCAGGAGACTAGG - Intronic
1021906841 7:25342927-25342949 TCCTCATGTTGGAGGTGTGGTGG + Intergenic
1022097606 7:27150734-27150756 TCTCCATGGTGCTGGAGTGGGGG + Intronic
1022506812 7:30912649-30912671 TCCCCAGGGTGCAGGGCTGCAGG - Intronic
1023691813 7:42797011-42797033 TCCCTGAGCTGCAGGTGTGTTGG - Intergenic
1023871290 7:44264333-44264355 TTCCCCTGGAGCAGGTGTGGTGG + Intronic
1024009721 7:45257319-45257341 TGCCCATGGAGGGGGTGTGTAGG + Intergenic
1024143298 7:46483917-46483939 TCCCCAGGGAGCTGGTGTGAGGG - Intergenic
1026149258 7:67774142-67774164 TCTACATGGTGCTGGTGTTTAGG + Intergenic
1026805633 7:73428569-73428591 GCCCCAGGGAGCAGGTGTGTCGG + Intergenic
1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG + Intronic
1031101568 7:117486855-117486877 TGGCCATGGTGGAGGTGGGTGGG + Intronic
1032038172 7:128535363-128535385 TCCCCATACTGCAGATGTGGAGG - Intergenic
1033192331 7:139292954-139292976 TACTCATGGTTCAGGTGTTTGGG + Intronic
1035054998 7:156029242-156029264 GCCCCAAGGGGCAGGTCTGTAGG - Intergenic
1035243192 7:157545485-157545507 TGCGCAGTGTGCAGGTGTGTGGG + Intronic
1037557563 8:20040551-20040573 TCCCTCAGCTGCAGGTGTGTTGG + Intergenic
1037650470 8:20833522-20833544 TCCCCAAGTTGGAGGTGTTTGGG - Intergenic
1037658397 8:20906785-20906807 ACCCATTGGTGCAGGTGGGTAGG - Intergenic
1037755034 8:21705050-21705072 TCCCCCTGGTGCAGCTGTCGTGG - Exonic
1038621748 8:29150330-29150352 TCCCCATGGTGTAGCTGTATTGG + Exonic
1039716844 8:40118956-40118978 GCCCCATAGTTCAGGTGAGTGGG + Intergenic
1040023646 8:42762361-42762383 GCGCCATGGTCCAGGTGTGGTGG + Intronic
1040607178 8:48945876-48945898 TCCCCCAGGTGCAGGTCTGTTGG + Intergenic
1041176212 8:55199530-55199552 TCCCCATTGTGCAGATGAGGGGG + Intronic
1042024164 8:64405133-64405155 TCCCTCAGGTGCAGGTCTGTTGG + Intergenic
1042721074 8:71827441-71827463 TACCAATGGTGATGGTGTGTAGG - Intergenic
1044854263 8:96458302-96458324 TCCCAATGGTTCATATGTGTAGG - Intergenic
1045300655 8:100907720-100907742 TCACCATGTTGCAGGTGACTAGG - Intergenic
1049482485 8:142833312-142833334 CCCCGATGGAACAGGTGTGTGGG + Intergenic
1049483227 8:142837709-142837731 CCCCGATGGAACAGGTGTGTGGG - Intronic
1050781885 9:9347012-9347034 AGCCCCTGGGGCAGGTGTGTTGG + Intronic
1051184328 9:14442586-14442608 TCCCCAAGCTGCAGGTTTGCTGG + Intergenic
1051792513 9:20822995-20823017 TCAACATGGTGCAGATATGTTGG + Exonic
1052649858 9:31288623-31288645 TCCATTTGGTGCAGGTCTGTTGG + Intergenic
1056248871 9:84727851-84727873 TCCCCATTGTTCATGTGAGTGGG - Exonic
1056968504 9:91183863-91183885 TACTCATGGTGCAGGGGTGGAGG - Intergenic
1057066463 9:92056605-92056627 TGTACATGGTTCAGGTGTGTGGG + Intronic
1057353291 9:94317490-94317512 TCCCGTTGGTGATGGTGTGTTGG + Intergenic
1057654460 9:96940102-96940124 TCCCGTTGGTGATGGTGTGTTGG - Intronic
1059695803 9:116729044-116729066 ACCCCATGGTGCAGCAGTGGCGG - Exonic
1061676348 9:132218139-132218161 CCCCCATGGTGCTGGTGGGCAGG - Intronic
1062375953 9:136262016-136262038 TCCCCATGGAGCAGGGGAGGGGG - Intergenic
1185589759 X:1267578-1267600 TGCCCTGTGTGCAGGTGTGTGGG + Intergenic
1185589789 X:1268097-1268119 TGCCCTGTGTGCAGGTGTGTGGG + Intergenic
1185754038 X:2638496-2638518 CCCCCATGGTGCTGTTGTGGCGG + Intergenic
1187485398 X:19698577-19698599 TGCCCATGGTGCACCTGTGATGG - Intronic
1187660967 X:21545809-21545831 TCCCTCTGGTGCAGGTCTGCTGG - Intronic
1188759354 X:34006859-34006881 TCAACATGTTGCCGGTGTGTGGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1192078977 X:68029652-68029674 ACCCCATGGTGAAGGTGAGAGGG + Intergenic
1193660294 X:84249112-84249134 TCTCCATGGGGCAGGGGTGGGGG + Intergenic
1194783031 X:98048607-98048629 GCCCCTTGCTGCAGGTCTGTTGG + Intergenic
1197837012 X:130705739-130705761 ACCCCAGGGTGCAGGTCAGTGGG - Intronic
1198303502 X:135354891-135354913 TACCCAAGGAGCAGGTGTCTGGG + Intronic
1198430948 X:136565568-136565590 TCCCCATGGAGCAGCTGTGTGGG - Intergenic
1201077558 Y:10199163-10199185 TCCCCATGCGGCACGTGTGCTGG + Intergenic
1201913672 Y:19158925-19158947 TCCCCCAGCTGCAGGTCTGTTGG - Intergenic