ID: 1007167064

View in Genome Browser
Species Human (GRCh38)
Location 6:39836124-39836146
Sequence CTGTGAATCTGGCCGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007167064_1007167076 29 Left 1007167064 6:39836124-39836146 CCCTCTGCCGGCCAGATTCACAG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1007167076 6:39836176-39836198 TCATTCTCAGTTCTGTGCACTGG 0: 1
1: 0
2: 0
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007167064 Original CRISPR CTGTGAATCTGGCCGGCAGA GGG (reversed) Intronic
900791116 1:4681505-4681527 CTGGGCTTCTGGCCTGCAGAAGG + Intronic
900894382 1:5473144-5473166 CTGTGCATTTGGCAGGCAGTCGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903056532 1:20640000-20640022 CAGTCAGTCTGGCAGGCAGAGGG - Intronic
903806113 1:26006744-26006766 GTGTGAATCTGCCTGGCTGAGGG - Intergenic
904412788 1:30335118-30335140 CTGGGCATCTGGCCTGCTGAGGG - Intergenic
906665887 1:47621758-47621780 GTGTGGAGCTGGCCTGCAGACGG + Intergenic
910874856 1:91868903-91868925 CTGTTTATCTGGACGGCAGTGGG - Intronic
915446232 1:155976429-155976451 TTGGGAATCTGGCTGGCAGCAGG - Intronic
917568938 1:176243771-176243793 CTGTTAATCTGGCTAGCAGTTGG + Intergenic
918489325 1:185063799-185063821 CTGGGAAGCTGGCCTGAAGATGG - Intronic
919180852 1:194079407-194079429 CAGTGAATTTAGCCGGGAGATGG + Intergenic
920099420 1:203507717-203507739 CTGAGAATGGGGCAGGCAGAGGG - Intronic
921739883 1:218671580-218671602 GTGTGAATCTGGCTCCCAGATGG - Intergenic
923038635 1:230303281-230303303 CTGTGAATCTGTCCACCAGATGG - Intergenic
923280570 1:232439278-232439300 CTGTGCACCTGGCAGGCAGCAGG - Exonic
1067432455 10:46253086-46253108 CTGAGAACCTGGCTGGCTGAAGG + Intergenic
1069558861 10:69415768-69415790 CTATGAATCTGGAAGGCAGGGGG - Intronic
1070353065 10:75611864-75611886 CTGTGTATCAGGCCTGCAAAAGG + Intronic
1070803350 10:79256203-79256225 CTTCGAACTTGGCCGGCAGAGGG + Intronic
1071979204 10:90986809-90986831 CTGGGAATGTGGCCTGCTGATGG + Intergenic
1073403434 10:103277046-103277068 CTCAGAGTCTGGCCGGGAGAGGG - Intergenic
1077098722 11:811521-811543 CTGTGACTCTGGGAGGGAGAGGG + Intronic
1077963570 11:7101834-7101856 CTGTTACTCTGGCCTGCAAATGG + Intergenic
1078594277 11:12673854-12673876 CTGGGAATCTGGCCCGGAGACGG + Intergenic
1078662198 11:13296617-13296639 TTGTGAATGTGGCCCTCAGAGGG + Intronic
1079125289 11:17714419-17714441 CTGCGTATCTGGCCGGGAGGTGG - Intergenic
1081693007 11:45090800-45090822 GTGTGAATGAGGCTGGCAGAGGG + Intergenic
1083856306 11:65394667-65394689 CTCTGACCCTGGCCGGCAGGAGG - Intronic
1084307839 11:68298452-68298474 CTGCGATCCTGGCCTGCAGAGGG + Intergenic
1085842567 11:80029233-80029255 CTGGGAGTGTGGCTGGCAGATGG - Intergenic
1089152843 11:116377511-116377533 CTCTGCATCGGGCAGGCAGATGG - Intergenic
1091057574 11:132433165-132433187 CAGTGACTCTGGCAGGCATATGG + Intronic
1093231120 12:16543141-16543163 CTGAGAATCTGACATGCAGAAGG + Intronic
1093439989 12:19183794-19183816 GTTTGAACCTGGCAGGCAGAGGG - Intronic
1095248728 12:39953932-39953954 CTGTGAACCTAGCCTACAGAAGG + Intronic
1095335696 12:41023007-41023029 CTGTGACTGTGGCCGGTAGGGGG + Intronic
1095809300 12:46355028-46355050 CTGGGAATGTGGCCCTCAGAAGG - Intergenic
1096026353 12:48366532-48366554 CTGTGAATGTTACCGGCAAATGG - Intergenic
1099278712 12:80613732-80613754 TTGTGAATCTGGACAGCAGTAGG - Exonic
1103619038 12:122174694-122174716 CTGTGAATGTGGCGGGTCGAAGG + Intronic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1105515469 13:21085855-21085877 ATTTGAATCTGGGAGGCAGAGGG + Intergenic
1105606867 13:21933210-21933232 CTGGGAACTTGGCTGGCAGAGGG + Intergenic
1109439497 13:62350563-62350585 CTGTGAATCTGTCTGGCATTGGG + Intergenic
1114450107 14:22819816-22819838 GTGTGACTCTGGCCGGCAGCGGG + Intronic
1118331791 14:64821073-64821095 GTGTGATTCTGGCAGGCAGAAGG - Intronic
1121372188 14:93369731-93369753 TTGTGTTTCTGGCAGGCAGAGGG + Intronic
1122060915 14:99136189-99136211 CTGGGAGCCTGGCCTGCAGAGGG + Intergenic
1122787746 14:104171735-104171757 CTGCGGATCTGGCCCGCACAGGG + Exonic
1123215960 14:106809697-106809719 CTGTGGACCTGGCAGGCTGAGGG - Intergenic
1124121414 15:26892261-26892283 CTGGGAATGTGGCTGGCACACGG - Intronic
1125228218 15:37420545-37420567 CTGTAGATCTGGCCATCAGAAGG - Intergenic
1128135624 15:65261185-65261207 CGGAGAATCTGGCAGGCAAATGG + Intronic
1129773596 15:78218454-78218476 CTCTGAATGTGGCAGGCAAAGGG + Intronic
1129865698 15:78906833-78906855 CTGTGAATATGGCCCATAGATGG + Intergenic
1130509730 15:84579407-84579429 CTGTCCATCTTGCAGGCAGATGG - Intergenic
1130585439 15:85177348-85177370 CTGTCCATCTTGCAGGCAGATGG + Intergenic
1133017200 16:2949518-2949540 CTGTGAAGCTGTCTGACAGAAGG - Exonic
1137292806 16:47063435-47063457 CCGAGAATGTGGCCAGCAGACGG + Intergenic
1142098576 16:88259346-88259368 CGCAGAATCTGGCGGGCAGAGGG - Intergenic
1144553437 17:16261168-16261190 CTGGGAATGTGGCAAGCAGAGGG - Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145988757 17:29065493-29065515 CTGTGAAGCTGGTCAGGAGAGGG - Intergenic
1146546926 17:33748135-33748157 CAGAGAGTGTGGCCGGCAGAAGG - Intronic
1149704944 17:58686485-58686507 ATTTGCATCTGGACGGCAGAGGG + Intronic
1151658495 17:75506798-75506820 CTGTGAATTTGGCCGACTCAAGG - Exonic
1152434888 17:80270356-80270378 CTGGGAATCTGTCCTCCAGACGG - Intronic
1156580599 18:38370452-38370474 CAGTGAATCTGGAAGGCAGGAGG + Intergenic
1159122571 18:64187601-64187623 CTGTGAAAAAGGCCAGCAGACGG - Intergenic
1162702140 19:12524369-12524391 CTTTGAATCTGGGAGGCAGAGGG + Intronic
1163313211 19:16526135-16526157 CAGTGTATCTGCCCAGCAGACGG - Intronic
1164736616 19:30545867-30545889 ATGTGCATCTGGCAGGCAAAGGG - Intronic
1165431695 19:35776547-35776569 CAGTGAATCTGTCTGGCAGCTGG + Intronic
1167411740 19:49348074-49348096 CTCTGCATCTGGCCAGCAGATGG - Intronic
1168407906 19:56120531-56120553 CGGGGATTCTGGCCGGCAGGAGG - Intronic
926688802 2:15718563-15718585 CAGTGAATCTGGCAGGATGAAGG - Intronic
929919147 2:46160301-46160323 CTGAGAATCTGGAAGGCAGAAGG - Intronic
931459669 2:62439657-62439679 CTGGGAATTTGGGCGGCAAATGG + Intergenic
932594211 2:73084081-73084103 CTGGGGAGCTGGCCGGGAGAGGG - Intronic
932839634 2:75069945-75069967 CTGTGAATGTGGGCAGCACATGG - Intronic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
947131330 2:226929033-226929055 CTGTGAATCTGTCTGGCACTGGG - Intronic
947729460 2:232420014-232420036 CAGTGAATGAGGCCGGCAGCTGG - Intergenic
1172115649 20:32572008-32572030 GTGTGAATCTGCCTGGCAGAGGG - Intronic
1172590336 20:36113198-36113220 CTGTGATTCTGGCAGGGCGAGGG + Intronic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1174107527 20:48173218-48173240 CTGTAATTCTGGCTGGCAGGTGG - Intergenic
1174157661 20:48527106-48527128 CTGTGTCGCTGGCCTGCAGAAGG - Intergenic
1174710400 20:52698337-52698359 CTGTGAATCTCCCCTTCAGATGG + Intergenic
1175262963 20:57686254-57686276 CTGGGCATCTGGCAGGCAGCAGG - Intronic
1175984631 20:62758500-62758522 CTGTGACTGGGGCCGGGAGAAGG + Intronic
1176389141 21:6154690-6154712 CTGAGAAATAGGCCGGCAGAGGG - Intergenic
1179734331 21:43383558-43383580 CTGAGAAATAGGCCGGCAGAGGG + Intergenic
1179991410 21:44949921-44949943 CTGGTGATCTGGCCAGCAGAGGG + Intronic
1180200747 21:46222685-46222707 CTCTGTATCCGGCTGGCAGAGGG + Exonic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181457122 22:23066109-23066131 CTGTTAATTTTGCTGGCAGATGG + Intronic
1183328808 22:37208491-37208513 CTGTGAACCTGGGGGGCAGGTGG + Intronic
1183585658 22:38751553-38751575 CTCTGAATCTCACCAGCAGATGG + Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
949640726 3:6033051-6033073 CTGTGAATCTGGCTGGTGTAGGG + Intergenic
950950586 3:16994240-16994262 ATGTGAATTTGGACTGCAGAAGG - Intronic
958079538 3:88728660-88728682 CTGTGCATCTGGCTGACAGATGG + Intergenic
959918708 3:111847568-111847590 CTGTGCATTTGGCCGTGAGAGGG - Intronic
960618955 3:119621121-119621143 CTGTGAATCTGCCCAGCAGCTGG - Intronic
961345061 3:126258910-126258932 CTGTGAATCTGTCCTGCAGAAGG - Intergenic
961601388 3:128064911-128064933 CTGTGCGTGTGGCCAGCAGATGG - Exonic
962712177 3:138097442-138097464 CTGTGAATGGGGCAGTCAGATGG - Intronic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
971054906 4:22901060-22901082 CTGTGAACCAGGCAGGCAGCAGG + Intergenic
974345152 4:60669754-60669776 CTCTGATTCTGGGCTGCAGATGG - Intergenic
975040703 4:69742479-69742501 CTGTGAATCTGTCTGGCCCAGGG + Intronic
979901322 4:126221932-126221954 CTCAGAATCTGGCCAACAGATGG + Intergenic
979930998 4:126630401-126630423 CTGTGAATCTGTGCCGAAGAGGG + Intergenic
981438739 4:144757836-144757858 CTGTGAATCTGTCTGGCCCAGGG - Intergenic
984173233 4:176385625-176385647 ATCTGAATATGGCCTGCAGATGG - Intergenic
985484737 5:141591-141613 CTGTGAATGTGGCCTCCAGTTGG - Intronic
987104728 5:14626879-14626901 CTGTGGATCTGGCCTGGAAATGG - Intergenic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
998041827 5:138955393-138955415 CTGTAAATCTTGCAGGGAGATGG + Intronic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999540152 5:152562439-152562461 CTCTGGATCTGGCCCACAGAGGG - Intergenic
1000336782 5:160247170-160247192 CTTTGAACCTGGAGGGCAGAAGG + Intergenic
1004083231 6:12416928-12416950 GTGTGAATCTGGATGGCAGCTGG - Intergenic
1004772462 6:18799378-18799400 CTCTGAAAGTGGCTGGCAGAGGG - Intergenic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1007167064 6:39836124-39836146 CTGTGAATCTGGCCGGCAGAGGG - Intronic
1007777197 6:44230390-44230412 CCGTGTAGCTGGCAGGCAGAAGG - Exonic
1007935544 6:45728968-45728990 CTTTGAATCTTGCAGTCAGAGGG + Intergenic
1009599119 6:65775184-65775206 CTGTGAATCTGTCTGGTATAGGG - Intergenic
1010459265 6:76095338-76095360 CTGTGAATCTGTCTGGTTGATGG - Intergenic
1011098476 6:83694322-83694344 CTATGCATCTGGCTGACAGAGGG - Intronic
1013140539 6:107329457-107329479 CTGTGAGGCTGGCCTGTAGATGG + Intronic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021996548 7:26183463-26183485 CTTTGAACCTGGGAGGCAGAGGG + Intronic
1022719554 7:32930654-32930676 CTGTAAACCTGGCAGGCAGGCGG - Intergenic
1024871318 7:53964506-53964528 CTGTGAAACTTGCCCTCAGAGGG + Intergenic
1025888454 7:65621760-65621782 CCGTGAAACTGGCCAGCAGGTGG + Intergenic
1028273421 7:88821076-88821098 TTGTGAATTTGGCCTACAGAAGG + Intronic
1028347486 7:89800050-89800072 CTGTGAATCTGGGATCCAGATGG + Intergenic
1030159825 7:106495855-106495877 CTGTGAATCTGCCTGGCCCAGGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034925004 7:155114139-155114161 CTGCCAAGCTGGCCTGCAGAGGG - Intergenic
1037108888 8:15142515-15142537 CTGTGAGTCTTGCAGGCTGAGGG - Intronic
1044932202 8:97261054-97261076 TTGTGAATGTGGGTGGCAGAGGG - Intergenic
1046617575 8:116494411-116494433 CTGTGAACCTGGCCCTCAAATGG - Intergenic
1047020687 8:120772326-120772348 CTTTGAACCTGGGAGGCAGAGGG - Intronic
1050523364 9:6524692-6524714 GTGTGAACCTGGGAGGCAGAGGG - Intergenic
1052079021 9:24180286-24180308 CTGTGAAAGTGGCCAGGAGAGGG - Intergenic
1052849719 9:33370059-33370081 CTGTGATTCTGCCAGGCAGAGGG - Exonic
1053380893 9:37649450-37649472 CCGTGGATCTGGGTGGCAGAGGG + Intronic
1056007029 9:82283796-82283818 CTTTGACTCTGGGCTGCAGAAGG + Intergenic
1057194485 9:93109274-93109296 GTGTGAAAATGGCAGGCAGATGG - Intronic
1062252737 9:135606433-135606455 CTGGGACCCTGGCCTGCAGAAGG + Intergenic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1190931624 X:54953419-54953441 CTGTGCATCTGGCAGGGAGTGGG + Intronic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1201683952 Y:16680745-16680767 CAGTGAATCAGGCTGCCAGATGG - Intergenic