ID: 1007167090

View in Genome Browser
Species Human (GRCh38)
Location 6:39836308-39836330
Sequence CCTTCTTTAAGAAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007167090 Original CRISPR CCTTCTTTAAGAAGGCTGGA AGG (reversed) Intronic
901026384 1:6280718-6280740 CATTGTGTAAGAATGCTGGAGGG - Intronic
901364187 1:8731427-8731449 CCTTCTGTGAGAAGGCAAGAGGG - Intronic
902077062 1:13795745-13795767 CCTTCTCTAACAAAGCTGGAGGG - Intronic
902537458 1:17128515-17128537 CATTAATTAAGAAGGCAGGAGGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903159714 1:21477977-21477999 CCTTCTAAATGCAGGCTGGAGGG - Intronic
903351582 1:22720044-22720066 CCCTCATAGAGAAGGCTGGAAGG + Intronic
905285337 1:36875862-36875884 AGTTCTTTTAGAATGCTGGAAGG - Intronic
906117815 1:43367586-43367608 CTTCCTTTAAGATGGATGGAAGG + Exonic
906532694 1:46532685-46532707 CCTACTTTCAGCAAGCTGGATGG + Intergenic
907539059 1:55195603-55195625 CCTTCTTTTTAAAGGCTGAATGG - Intronic
910261426 1:85297099-85297121 GCTTCTTTAAGAAGGATGTCAGG + Intergenic
915772188 1:158438182-158438204 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
916741925 1:167653757-167653779 CCTTCTTTAAGAAGCCTTCATGG - Intronic
916741928 1:167653765-167653787 GCTTCTTAAAGAAGGCAGGAAGG + Intronic
917300359 1:173567746-173567768 CCTTCATTGAAAGGGCTGGAAGG - Intronic
922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG + Exonic
923255533 1:232218513-232218535 CCTTCTTTTATAAGCCAGGATGG + Intergenic
1062931650 10:1356735-1356757 CTTTGCTTGAGAAGGCTGGAGGG - Intronic
1063235834 10:4115467-4115489 CGTTATTTAAGAAGTCTGTAGGG - Intergenic
1063847800 10:10150567-10150589 CCTACTTTTAGAAGGCTTTAGGG - Intergenic
1064164485 10:12974545-12974567 CCTGCCTTCAGAAGGCTGAAAGG - Intronic
1064328537 10:14372963-14372985 CCTTTTTTAAGAAGGATGGTCGG - Intronic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1067557081 10:47279855-47279877 CATTCTTTCTGATGGCTGGAAGG - Intergenic
1067828752 10:49597926-49597948 CCTTCATTAACAAGGACGGATGG + Intergenic
1068573873 10:58661374-58661396 CCTCCTTTAGGAAAACTGGAAGG + Intronic
1069154534 10:65010890-65010912 CCTTCATACAGAAGGCTAGACGG + Intergenic
1069667951 10:70176507-70176529 CCTGCTTTAAAAAGACTAGATGG - Intergenic
1074279404 10:112036746-112036768 TGTTCTTTAAGAAGCCTGGGAGG - Intergenic
1074788684 10:116864702-116864724 ATTTTTTTAAAAAGGCTGGAAGG - Intronic
1076220276 10:128728240-128728262 CCCACTTAATGAAGGCTGGAAGG - Intergenic
1079084253 11:17433874-17433896 CCTTCCTCATGAAGGCTAGATGG + Intronic
1081299333 11:41431387-41431409 CCTTCCTTAGGAAGGAAGGAAGG + Intronic
1081883433 11:46473955-46473977 CCTTCTTTAAGAATCCTTAAAGG - Intronic
1082882850 11:58055328-58055350 GCTTCTTTAAGAAGGCTTTTAGG - Intronic
1085635894 11:78159332-78159354 ACTTCTTTGAGAATGCTGGTGGG + Intergenic
1089426556 11:118381297-118381319 CCTTCATTAAGTAGGGTGAAAGG + Intronic
1089875778 11:121720420-121720442 GCTTCTTTAAGAATGATGTAAGG - Intergenic
1089906973 11:122049966-122049988 CCTTCCTTTAAAAGGCTGAATGG + Intergenic
1091137418 11:133204418-133204440 CCTTCTTTATGAAGACCTGATGG - Intronic
1091399621 12:174132-174154 TCCTCTATAACAAGGCTGGAGGG + Intronic
1094701636 12:32876015-32876037 CCTTCTTTGAGCAGGCAGAAAGG + Intronic
1095699536 12:45176537-45176559 TGTTCTTTAAGAAGGTGGGATGG - Intergenic
1096546362 12:52342837-52342859 CCTGCAGGAAGAAGGCTGGAGGG - Intergenic
1096795470 12:54074825-54074847 ACTTCTTTAAGAAGGTTGGAAGG + Intergenic
1100913025 12:99387319-99387341 CCTTATTAAAGAAGCCTGGCCGG + Intronic
1103857620 12:123984435-123984457 CAGTCTTTAAGAGGTCTGGATGG + Intronic
1104602166 12:130161705-130161727 TCTCCTCTAAGAAGGCGGGAAGG - Intergenic
1106454401 13:29914070-29914092 CCTTCTTTAAAACGGCTAAATGG + Intergenic
1106553127 13:30788457-30788479 CCCTCTCTGAGAAGGCTTGAGGG - Intergenic
1106559318 13:30834681-30834703 CCTTCTATAAATAGGGTGGACGG + Intergenic
1106853131 13:33817111-33817133 CTTTCTATAATAAGCCTGGAAGG - Intergenic
1106947443 13:34844623-34844645 CTTTTTGTAAGAAGCCTGGAAGG + Intergenic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107509739 13:41071719-41071741 GCTTTTGTTAGAAGGCTGGATGG + Intronic
1108541125 13:51447271-51447293 GCTTCTTTTTGAAGGCTGGCAGG - Intronic
1108881836 13:55130152-55130174 CCATCTTTATGAAGGCAGGATGG + Intergenic
1109159216 13:58950838-58950860 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
1109706463 13:66099738-66099760 AATTCTTTATAAAGGCTGGAAGG + Intergenic
1118011852 14:61617802-61617824 CATTCTGTAAGAAGCCTGGGAGG + Intronic
1119783113 14:77291653-77291675 CCTCCCTCTAGAAGGCTGGATGG - Intronic
1120172904 14:81263770-81263792 ATTTCTATAAGCAGGCTGGATGG + Intronic
1121523745 14:94604047-94604069 CCTTCTTTAAAAATGAAGGAAGG - Intronic
1122261954 14:100528803-100528825 ACTTCTTTCTGGAGGCTGGAGGG - Intronic
1122685049 14:103499956-103499978 CCTTCTTCCACAAGGCTGCAGGG - Intronic
1124198401 15:27655120-27655142 CCTTCTTTTTGAAGGCTATATGG - Intergenic
1125636111 15:41189885-41189907 CCTTCCTTGAGAAGGCAGAAAGG + Intronic
1127905966 15:63376237-63376259 GCTTCTCTAAGATGTCTGGAAGG - Intronic
1128051400 15:64667899-64667921 CCTCCTTTCATAAGGCTGGTTGG - Intronic
1131267238 15:90923772-90923794 CCTTCTTCATGAAAGCTGGATGG - Intergenic
1132699003 16:1214316-1214338 CCTTCTTCTAAAAGGCTGGGAGG - Intronic
1133486253 16:6222045-6222067 CCATATTTAAGAAGTATGGAAGG + Intronic
1138085606 16:54131272-54131294 TCATCTTGAAGGAGGCTGGAGGG + Intergenic
1142628258 17:1206080-1206102 CCTTCTGTCACCAGGCTGGAGGG - Intronic
1142864994 17:2785297-2785319 CCTTCCTTAACAGGGCTGGAAGG - Intronic
1146542970 17:33713346-33713368 CCCTCTTTCTGAAGGCTAGAGGG + Intronic
1147332871 17:39709232-39709254 TCCTCTTTTAGAAGGCAGGAGGG + Intronic
1148398622 17:47332746-47332768 CCTTCTTTTTAAAGGCTGTATGG + Intronic
1150650899 17:67009480-67009502 CCTTCTTAAAGGAAGCTGCATGG - Intronic
1151092715 17:71461195-71461217 CTTTCTTTGAGAAGCTTGGATGG + Intergenic
1153645114 18:7188609-7188631 CCTTCTTTTTTAAGGCTGTATGG - Intergenic
1153887128 18:9476533-9476555 GCTTTTCTAACAAGGCTGGATGG - Intronic
1155933894 18:31735183-31735205 CCTTCTTTTTTAAGGCTGAATGG - Intergenic
1156316421 18:35972800-35972822 CCTCCTGTAAGAGGACTGGAGGG + Exonic
1157685959 18:49642739-49642761 CCTTCTTTCTTAAAGCTGGATGG + Intergenic
1158993467 18:62893354-62893376 CATTCTTTAAGAAGGCCTAACGG + Intronic
1160314510 18:77829106-77829128 CCATCTTGAAGAAGGCTGTGAGG + Intergenic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161912900 19:7207878-7207900 CCTTGTTTGAGAAGGAAGGAAGG + Intronic
1161982202 19:7635919-7635941 CCGAGCTTAAGAAGGCTGGAGGG - Intronic
1163625598 19:18387737-18387759 CCTATTTTAGGCAGGCTGGAAGG + Intronic
1165136812 19:33674743-33674765 CCTTCTCTACGCAGCCTGGAGGG - Intronic
1165366218 19:35367320-35367342 TTTTCTTTAAGAAGCCTAGAAGG - Intergenic
1166625897 19:44355945-44355967 ACTTCTTGAAAAAGGCTGCAGGG - Intronic
1168012842 19:53547365-53547387 CCTTCTTTATAAAGGCTGGATGG + Intronic
925579415 2:5395424-5395446 CCTGCCTTAAGATGGCTGGCTGG - Intergenic
926058008 2:9787539-9787561 GATTCTTTAAGAAGGCTTGAGGG - Intergenic
926907823 2:17822381-17822403 CCTTCTTAGAGCAGCCTGGAAGG + Intergenic
927597579 2:24410159-24410181 CCACATTTAAGAAGGCAGGAAGG + Intergenic
928142031 2:28738094-28738116 CCTTGTTTAAGAAATCTGGCTGG + Intergenic
930927908 2:56842576-56842598 CCTTGGTTAAGAACTCTGGAAGG - Intergenic
931598564 2:63977951-63977973 CCTTATTTAAGAGGTCTGCAGGG - Intronic
933839663 2:86276252-86276274 CCTGCTTCCAGAAGGCTGGCTGG - Intronic
935100727 2:99993006-99993028 CCTTCTTCCTGATGGCTGGAAGG + Intronic
935305169 2:101730483-101730505 CCGTGTTTAAGAAGGTTGGGTGG + Intronic
936232651 2:110717164-110717186 TGTTCTTTAGGAAGGCTGGCAGG - Intergenic
937618507 2:123956870-123956892 CCTACTTGAAGAATGTTGGAGGG - Intergenic
937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG + Intronic
938547548 2:132348203-132348225 ACTTCTTGAAAAAGGCTGCAGGG + Intergenic
939892525 2:147754480-147754502 CATTCTTTAAGAAGGTATGAAGG - Intergenic
940261563 2:151785243-151785265 CCTTCTTTTTTAAGGCTGAATGG - Intergenic
940381905 2:153024770-153024792 CCTTCTTTTAGAAGGTCTGAGGG - Intergenic
941880707 2:170477280-170477302 CCTTCTCTATGAAGGCTGCCTGG + Intronic
942748188 2:179259908-179259930 CACTCTTTAAGAAGGATGGTAGG - Intronic
946308249 2:218868337-218868359 CCTCCCTTAAGAAGGCAGGAGGG - Intronic
948801265 2:240434725-240434747 CCTCTTTGAAGAAGGCGGGAGGG - Intergenic
1169525690 20:6422881-6422903 CCTTCTTACAGAAGACGGGAGGG + Intergenic
1169693422 20:8358910-8358932 CCTTCATTAAAAAGCCTGAAAGG - Intronic
1170678753 20:18506166-18506188 GCATTTTTAAGAAGTCTGGAGGG - Intergenic
1171303929 20:24088820-24088842 CCTTATTTAAGAAGTCTCTAGGG - Intergenic
1171958388 20:31476397-31476419 CCTTCTTTCAGAAGGAAAGAAGG + Exonic
1172978590 20:38924585-38924607 CCTGATTGAAGAGGGCTGGAAGG + Intergenic
1178433207 21:32534703-32534725 CCATCTTTAAAAAGGAAGGAAGG + Intergenic
1181749640 22:24980107-24980129 CCTTCTTTTTAAAGGCTGGATGG + Intronic
1182150125 22:28021843-28021865 ACATCTTTAGGATGGCTGGAAGG + Intronic
1182896744 22:33865187-33865209 CCTTCTTGAAGATGGGTGAAGGG - Intronic
1183323672 22:37180181-37180203 CATTCTTTAATCATGCTGGACGG + Exonic
1184769491 22:46589210-46589232 CCCTCTTTAACAAGGCTCCAGGG - Intronic
1185281926 22:49975937-49975959 CCTTCCCTAAGGAGGCCGGAGGG + Intergenic
951286798 3:20823238-20823260 CCTTCCTTATGAAGGAAGGAAGG + Intergenic
953211264 3:40877280-40877302 CATTCCTTAAGAAGGAGGGATGG + Intergenic
955572372 3:60321871-60321893 CCCTCTTAAAGGAGGTTGGAGGG - Intronic
956856406 3:73279346-73279368 CTTTCTTTATGAAGGGTGTAAGG + Intergenic
959959964 3:112287130-112287152 CCTTCTTTCAGACAGTTGGATGG - Intronic
960297027 3:115956885-115956907 ACTTCTTCAAGAAGCCTGTAAGG - Intronic
960596074 3:119409387-119409409 CCCTGTTTCAGAAGGATGGAGGG - Intronic
961352110 3:126310713-126310735 CCTTTTTTAAGAAGTCTTAATGG + Intergenic
961678392 3:128582457-128582479 CCTTCTTGAAGTATGCTGGAAGG - Intergenic
962529768 3:136268170-136268192 CCTACTATAAGAAAGCTGGCTGG - Intronic
965168546 3:165229012-165229034 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
965779086 3:172264873-172264895 CCTTCTTTAATAAGGGTGCATGG + Intronic
965785314 3:172329130-172329152 CCTTCTTTTACATAGCTGGAAGG + Intronic
966218535 3:177527569-177527591 CTTCCTTTAAGAACGCTTGACGG + Intergenic
967367661 3:188706013-188706035 CCTTCTGTAAGAACCCAGGAGGG - Intronic
968322009 3:197778010-197778032 CAATCATTAAGATGGCTGGAGGG - Intronic
970446676 4:16129010-16129032 ACTTCTTGAAGAAAGCTGGTCGG - Intergenic
972431860 4:38990626-38990648 TCCTCTCTAAGAAGGCTGCAGGG - Intronic
977504140 4:97880108-97880130 CCTTCTTTTAGAAGGCTGTACGG - Intronic
979109874 4:116739604-116739626 CCTTCTTGAAGAAGGCTCCTGGG + Intergenic
979123191 4:116928726-116928748 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
982258359 4:153471616-153471638 TCTTCTCAAAGAAGTCTGGATGG - Intronic
982532859 4:156569213-156569235 GCTTCTTTAACAAAGCTGGGAGG - Intergenic
983009215 4:162524201-162524223 CTTTCTCTCAGAAGGCTGTAGGG + Intergenic
984509311 4:180659347-180659369 CTTTTTTTAAGAAGCCTGTAAGG + Intergenic
985157530 4:187005971-187005993 CCTTTTCTATGCAGGCTGGAAGG + Intergenic
990567344 5:57042767-57042789 CCTGCATTAGGAAGGCTGGCAGG - Intergenic
990827441 5:59917098-59917120 ACTTCTTCAAGAAGGATGGCCGG - Intronic
990967535 5:61465072-61465094 CCACCTTTAAGAAGGGTGGAAGG + Intronic
991120106 5:63003071-63003093 CCTTCTTTATTATGGCTGAATGG + Intergenic
991328771 5:65467621-65467643 TCTTCCTTAAGAATGATGGATGG - Intronic
992733523 5:79696054-79696076 GCTTCTTGTAGAAGTCTGGAAGG - Intronic
992737175 5:79734033-79734055 CCTTTTTAAAGTCGGCTGGATGG - Exonic
993525384 5:88959440-88959462 CATTCATTAAAAAGGCTGGGGGG + Intergenic
994652455 5:102545801-102545823 CCTACTTTAAGAAGGCTAGATGG - Intergenic
995077030 5:107997468-107997490 CCCTCATTAAGATGCCTGGAGGG - Intronic
995540253 5:113178802-113178824 CCTTCTGGTAGAAGGCAGGAGGG - Intronic
1000173106 5:158723231-158723253 CCTTCCCTAACCAGGCTGGAAGG + Intronic
1007015925 6:38466592-38466614 CCTTCTTTAAGAAGGAAAAAGGG - Intronic
1007167090 6:39836308-39836330 CCTTCTTTAAGAAGGCTGGAAGG - Intronic
1008101986 6:47401584-47401606 CCTTCTTGTAGAAGGGTGGACGG + Intergenic
1009423453 6:63488488-63488510 CCTTCATGAAAAAGGCTGAAAGG - Intergenic
1009531745 6:64826418-64826440 CCTTTTTTAAGCAGATTGGAAGG + Intronic
1010185593 6:73139958-73139980 CTATCTTTAAGAAGACTTGAGGG - Intronic
1010999379 6:82570655-82570677 CCTGCTTTAAGAAGGCTTCCTGG - Intergenic
1011771744 6:90680908-90680930 GGTTCTTTCTGAAGGCTGGAAGG + Intergenic
1014207887 6:118676522-118676544 CCTTCTTTCTTAAGGCTGTATGG + Intronic
1015378294 6:132535536-132535558 CCTATTTTTAGAAGGGTGGAGGG - Intergenic
1015565601 6:134567335-134567357 CCTGCTTTAGTAAGGATGGAAGG + Intergenic
1018526171 6:164712031-164712053 CCTTATTTAAGAAGTCTGTAGGG + Intergenic
1020501847 7:8932989-8933011 CCTCCTTTAGGAAAGCTGAAAGG + Intergenic
1020694880 7:11401304-11401326 CCTTATTTATGAAGGGTGGCAGG + Intronic
1020801378 7:12737057-12737079 CCTTCTGTCACCAGGCTGGAGGG + Intergenic
1020999085 7:15304971-15304993 CCTGCTTTGAGATGGCAGGAGGG - Intronic
1022913281 7:34920811-34920833 CCCTTCTTAAGGAGGCTGGATGG - Intergenic
1022945354 7:35278614-35278636 CCATCTTAAAGAAGGATGGGGGG - Intergenic
1023704125 7:42922080-42922102 TATTTTTTAAGAAGGCTAGAAGG + Intronic
1024147685 7:46534023-46534045 CCTTCTTTCAGAACTTTGGAGGG + Intergenic
1026486203 7:70823792-70823814 CCTTCTTTTTAAAGGCTGAATGG - Intergenic
1027506917 7:79027362-79027384 CCTTCTTTCTAAAGGCTGGGTGG - Intronic
1030233938 7:107238324-107238346 CTGTCTTTCTGAAGGCTGGATGG + Intronic
1031670226 7:124533727-124533749 CCTTCTCTAGGCAGACTGGATGG - Intergenic
1032075558 7:128834156-128834178 ACTGCTTTCAGGAGGCTGGAAGG - Intronic
1034871616 7:154690257-154690279 CCTTCTGTAAAAACTCTGGATGG - Intronic
1035572479 8:681953-681975 CCTTCATTAAGAATCCTGGTGGG + Intronic
1037881262 8:22574608-22574630 CCTTCTTTAACAGGGATGCAGGG - Intronic
1039771471 8:40692216-40692238 TCTTCAGTAACAAGGCTGGATGG - Intronic
1040555524 8:48474557-48474579 CCTTCTTTTTCAAGGCTGAATGG - Intergenic
1043730367 8:83670890-83670912 CATTATTTAAGAAGCCAGGAAGG - Intergenic
1044785955 8:95793018-95793040 CCATCTCTGAGAAGGCTGGTGGG - Intergenic
1044857198 8:96488615-96488637 CCTTCTTTTATAAGGCTAAATGG - Intergenic
1045491251 8:102671156-102671178 CCAGCTGTAAGCAGGCTGGAAGG + Intergenic
1047068054 8:121309402-121309424 CCTTCTTTTTAAAGGCTGAACGG + Intergenic
1049293808 8:141818951-141818973 CATCCTTAAAGAAGCCTGGAAGG + Intergenic
1049794524 8:144490587-144490609 CGTTCATTTGGAAGGCTGGATGG - Intronic
1050653668 9:7800052-7800074 ACTTCTTTAAGGAGACTGAAAGG - Exonic
1052851417 9:33380688-33380710 CCTTCTTCAGGAAGGAAGGAAGG - Intergenic
1055829024 9:80358751-80358773 TCTTCTGAAAGGAGGCTGGAAGG + Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056411612 9:86333941-86333963 CCTTTTTTAAGAAGTCTTTAGGG - Intronic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1058797452 9:108512344-108512366 ACTCCATTAAGAAGGATGGAAGG + Intergenic
1059249814 9:112878427-112878449 ACTTCTATGACAAGGCTGGAAGG - Intronic
1061463201 9:130757043-130757065 CCTTCTCACAGACGGCTGGAAGG - Intronic
1186680876 X:11872415-11872437 CTTTCTTCAGGAAGGCTGAAAGG + Intergenic
1186788754 X:12976380-12976402 CCATCTTTAGAAAGGCTGGGTGG + Intronic
1187571076 X:20502695-20502717 CCTTCTTTTAAAAGGCTGAATGG + Intergenic
1188294567 X:28431947-28431969 CCTTCTTTATTAAGGTTGAATGG - Intergenic
1188372551 X:29386574-29386596 CATTCTTTCACCAGGCTGGAGGG + Intronic
1188951854 X:36385799-36385821 CCTTCTTTTTAAAGGCTGAACGG + Intergenic
1189320679 X:40085316-40085338 GCTGCTTTAAGAGAGCTGGAAGG + Intronic
1194282318 X:91967887-91967909 CTTTCATTAACAAGGCTGAAAGG + Intronic
1195802703 X:108731784-108731806 CCCTCTTTTAGAAGGGTGGGGGG + Intronic
1196932393 X:120695226-120695248 CCTTCTTTTGAAAGGCTGAATGG + Intergenic
1197695458 X:129545187-129545209 CTTTCTCTAAGAATGCTGAAGGG + Intronic
1198097424 X:133393646-133393668 CTTTCTTTCAGAAGGTTGAAAGG - Intronic
1199042964 X:143136018-143136040 CCTTATTTAAGAAGTCTCTAGGG + Intergenic
1200599908 Y:5192539-5192561 CTTTCATTAACAAGGCTGAAAGG + Intronic