ID: 1007170608

View in Genome Browser
Species Human (GRCh38)
Location 6:39860642-39860664
Sequence CAGGGTGACCTGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007170598_1007170608 30 Left 1007170598 6:39860589-39860611 CCAGGGCGAGAGGATCAGGAGCT 0: 1
1: 0
2: 1
3: 71
4: 2442
Right 1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007170608 Original CRISPR CAGGGTGACCTGAAGCAGGA GGG Intronic
No off target data available for this crispr