ID: 1007174688

View in Genome Browser
Species Human (GRCh38)
Location 6:39887796-39887818
Sequence TGCCAGACGCTGACCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007174688_1007174691 0 Left 1007174688 6:39887796-39887818 CCCAGCCTGGTCAGCGTCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1007174691 6:39887819-39887841 GCTGAGTTGCTCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 17
4: 122
1007174688_1007174694 14 Left 1007174688 6:39887796-39887818 CCCAGCCTGGTCAGCGTCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1007174694 6:39887833-39887855 AGCCCACGGAGGGCCTCGCTTGG 0: 1
1: 0
2: 1
3: 8
4: 112
1007174688_1007174692 3 Left 1007174688 6:39887796-39887818 CCCAGCCTGGTCAGCGTCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1007174692 6:39887822-39887844 GAGTTGCTCTAAGCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 72
1007174688_1007174698 26 Left 1007174688 6:39887796-39887818 CCCAGCCTGGTCAGCGTCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1007174698 6:39887845-39887867 GCCTCGCTTGGCTCAGGCCATGG No data
1007174688_1007174693 4 Left 1007174688 6:39887796-39887818 CCCAGCCTGGTCAGCGTCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1007174693 6:39887823-39887845 AGTTGCTCTAAGCCCACGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 60
1007174688_1007174697 20 Left 1007174688 6:39887796-39887818 CCCAGCCTGGTCAGCGTCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1007174697 6:39887839-39887861 CGGAGGGCCTCGCTTGGCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007174688 Original CRISPR TGCCAGACGCTGACCAGGCT GGG (reversed) Intronic
900357859 1:2273370-2273392 TGCCACCCTCTGACCAGGATAGG - Intronic
900986841 1:6078118-6078140 CGCCAGACGCTGAAGAGGCTGGG - Intronic
902289949 1:15429153-15429175 TGCCAGCCCCTTCCCAGGCTGGG + Exonic
902579319 1:17398428-17398450 TGCCAGACGCTGTCTAGCCATGG + Intronic
902831071 1:19013046-19013068 TGCCAAACACCAACCAGGCTGGG - Intergenic
903288522 1:22292202-22292224 GGAAAGACGCTGGCCAGGCTGGG + Intergenic
904011730 1:27393754-27393776 TGTGAGAAGCTGACCAAGCTGGG - Intronic
907457696 1:54585975-54585997 GCACAGACGCTGACCAGGCAGGG - Intronic
907751289 1:57265761-57265783 TGACAGACGGAGAGCAGGCTTGG + Intronic
910693857 1:89992014-89992036 TGGGAGACGCTGCCCAGCCTTGG - Intergenic
912553145 1:110497390-110497412 TCCCAGACGCAGACCAGTCAGGG + Intergenic
919949444 1:202348978-202349000 CGGCAGCCGCTGACCAGGCGCGG + Exonic
1063981073 10:11452141-11452163 TGACAGCCTCTGACCAGGCTTGG - Intergenic
1064103725 10:12484258-12484280 TGCCAGCCGCAGAGCAGGCGGGG - Intronic
1066026089 10:31361988-31362010 TCCCAGACGGTGAGGAGGCTGGG + Intronic
1067705086 10:48600775-48600797 TGGCAGAGGATGTCCAGGCTTGG + Intronic
1070595577 10:77830580-77830602 TCCCAGCAGCTGTCCAGGCTGGG - Intronic
1070669518 10:78368270-78368292 TGACAGAGTCTGCCCAGGCTGGG + Intergenic
1071209094 10:83317366-83317388 AGCCAGAAGCTGTGCAGGCTGGG - Intergenic
1074853070 10:117454289-117454311 TGCCAGAGGCTGCACTGGCTGGG + Intergenic
1076184241 10:128434129-128434151 TGCCAGCAGGTGTCCAGGCTAGG - Intergenic
1077134780 11:993072-993094 TGCCACACGCTGACCTGCCCTGG - Intronic
1077675001 11:4187594-4187616 CGCCGGGCGCTGACGAGGCTCGG + Intergenic
1080117387 11:28636204-28636226 TGTCAGATGCTGTCCAGCCTTGG - Intergenic
1083767590 11:64849250-64849272 TGCCCGCTGCTGACCAGGCGTGG + Intergenic
1089566592 11:119375065-119375087 GGCCAGAGGCTGGCCAGGCTGGG - Intronic
1090028094 11:123184851-123184873 TGCCAGCCGCTCACCGGGCTTGG + Intronic
1090077366 11:123587762-123587784 TGCCAGCCACTCCCCAGGCTTGG - Intronic
1094545638 12:31402124-31402146 TGCCAAAGGATGACCAGGTTTGG + Intronic
1097186544 12:57199392-57199414 AGCCAGACGGTGAGCAGGCAAGG + Exonic
1100477961 12:94951452-94951474 TCCCAGAAGCAGACCAAGCTGGG + Intronic
1101025499 12:100600429-100600451 TCCCAGACACGGACCAGGATTGG + Exonic
1101728510 12:107407529-107407551 TGCAAGACGGTGAACAGGCAAGG + Intronic
1103177028 12:118873047-118873069 TACCAGACCCTCCCCAGGCTGGG - Intergenic
1104772904 12:131375422-131375444 TGCCAGCCGTTCAGCAGGCTTGG + Intergenic
1107373455 13:39777119-39777141 TGCCAGACACTGAGAAGGCAAGG + Intronic
1113546864 13:111159043-111159065 TACCAGATGCTGAGGAGGCTGGG - Exonic
1117484939 14:56186416-56186438 TGCCAGAAGTTCAGCAGGCTTGG - Intronic
1120502969 14:85320101-85320123 TTCCGGAGGCTGACCAGGCAGGG - Intergenic
1121693467 14:95894116-95894138 AGCCAGACGCTAACCCAGCTTGG - Intergenic
1122672671 14:103384605-103384627 TGCCAGCCTCGGGCCAGGCTCGG - Intergenic
1124587374 15:31022338-31022360 TGCCAGAAGTTGACCAGACATGG + Intronic
1125728061 15:41878206-41878228 TGCCAGACACCAACCAGTCTGGG + Intronic
1125871467 15:43105945-43105967 TGCCAGACGCTGAGGGGTCTGGG + Exonic
1132338242 15:101062522-101062544 TGCCAGACACTTTCCAGCCTGGG + Intronic
1132356618 15:101175535-101175557 AGCCAGACGCGGCCCAGGCCCGG + Intergenic
1134452187 16:14370335-14370357 TGGGAGCTGCTGACCAGGCTGGG + Intergenic
1136316532 16:29457779-29457801 TCCCAGAGGTGGACCAGGCTGGG - Intronic
1136431109 16:30197121-30197143 TCCCAGAGGTGGACCAGGCTGGG - Intronic
1136683960 16:31983426-31983448 TGGCAGATGCTGAGCAGGCATGG - Intergenic
1136784586 16:32926978-32927000 TGGCAGATGCTGAGCAGGCATGG - Intergenic
1136885197 16:33926828-33926850 TGGCAGATGCTGAGCAGGCATGG + Intergenic
1141766419 16:86062674-86062696 TGCCGCAGGCTGACCAGGCAGGG + Intergenic
1141890015 16:86920072-86920094 TGCTAGCAGGTGACCAGGCTCGG + Intergenic
1203087245 16_KI270728v1_random:1190984-1191006 TGGCAGATGCTGAGCAGGCATGG - Intergenic
1142470945 17:162970-162992 TGCCACACCCGGCCCAGGCTGGG + Intronic
1142848055 17:2691651-2691673 TCCAAGACGCTGGCCATGCTGGG + Exonic
1144467814 17:15510479-15510501 TACCAGACGTTGGCCAGTCTGGG + Intronic
1146399659 17:32493183-32493205 TGCAGGCAGCTGACCAGGCTTGG + Exonic
1147144885 17:38479129-38479151 TGGCAGACACTGAGCAGGCATGG - Intronic
1148124698 17:45230733-45230755 TACCCCACCCTGACCAGGCTGGG + Intronic
1150719901 17:67605407-67605429 TGGCAGCCGCTGTCCAGCCTGGG + Intronic
1150946044 17:69746747-69746769 TGCCAGTTGCTGGCCAGCCTAGG + Intergenic
1152542277 17:80982311-80982333 TGGCTGCAGCTGACCAGGCTGGG + Intergenic
1152554056 17:81044289-81044311 GGCCAGGCGGTGACCAGACTTGG + Intronic
1155177660 18:23314885-23314907 TGCCAGCCGTTGACAAAGCTAGG - Intronic
1155217194 18:23653711-23653733 TGCCTGACACTGACCATGCCTGG + Intronic
1155982545 18:32196252-32196274 TCCAAGACGCTGGCCATGCTGGG + Intronic
1157273915 18:46296826-46296848 AGCCAGAGGCTGAGCAGGCTGGG + Intergenic
1160241531 18:77127883-77127905 TACCAAATGCTGCCCAGGCTGGG + Intronic
1160448958 18:78949008-78949030 TGCCAGACCCCAACCAGGCACGG + Intergenic
1161279376 19:3437075-3437097 TTCCTGTCTCTGACCAGGCTCGG + Intronic
1161808712 19:6459504-6459526 CGCCAGGGGCTGGCCAGGCTGGG - Exonic
1162858717 19:13489565-13489587 TTACAGATGCAGACCAGGCTGGG - Intronic
1162958966 19:14114927-14114949 TGCCAGACGCCGGCCCGACTGGG - Intronic
1166693062 19:44835727-44835749 TGCCAGGGGCTGGCCAGGCATGG - Intergenic
1166863260 19:45821713-45821735 TGCCACACGCTACCCAGGGTGGG - Intronic
1168145837 19:54419818-54419840 TGCCAGATACTGACCAAGCCAGG + Intronic
1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
925368122 2:3324847-3324869 GGCCTGACCCTCACCAGGCTGGG + Intronic
926359429 2:12071662-12071684 TGCCACTTGTTGACCAGGCTGGG + Intergenic
927414290 2:22861321-22861343 TGCCAGAGGCTGAGAAGGATTGG - Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
930186984 2:48420393-48420415 TGCCAGGCGCTCTGCAGGCTCGG - Intergenic
932636827 2:73396937-73396959 TACCAGAGCCTAACCAGGCTGGG - Intronic
937274377 2:120674605-120674627 TGCTAGGCGCTGCTCAGGCTGGG - Intergenic
938000081 2:127726656-127726678 TGCAAGACTCTGCCCAGTCTTGG + Exonic
938480041 2:131654305-131654327 TATCAGACGCTGAGCAGGGTGGG - Intergenic
939133449 2:138265800-138265822 TACCAGAGGCTGAGCAGGGTAGG + Intergenic
941580953 2:167294218-167294240 TGCCAGAGGCGCACCAGGCCGGG - Intergenic
945598306 2:211824025-211824047 TCCCCGACTCTGTCCAGGCTTGG + Intronic
947428350 2:230004080-230004102 TGCAAGGAGCTGACCTGGCTGGG - Intronic
1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG + Intergenic
1172804858 20:37604466-37604488 TGCCAGACGCTGTTAAGTCTAGG - Intergenic
1172868809 20:38121679-38121701 TGCCAGACTCTTGCCAGGCGCGG - Intronic
1174215373 20:48912224-48912246 TGCCAGATGGTGAACAGCCTGGG - Intergenic
1174589188 20:51631673-51631695 TGCCAGATGCAGACCACGGTGGG - Intronic
1175750550 20:61494026-61494048 TGCCAGACAAAGAGCAGGCTGGG + Intronic
1176604775 21:8820004-8820026 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1178664074 21:34531578-34531600 TCCCTGATGCTGACCAAGCTCGG + Intronic
1180126277 21:45792339-45792361 TGCCAGACGCTGGCCTCGGTGGG - Intronic
1180347065 22:11711609-11711631 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1180354813 22:11829699-11829721 TGCCAGACCCTGTCCCGGCCCGG - Intergenic
1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG + Intergenic
1181639916 22:24190947-24190969 TGCCAGGGGCAGGCCAGGCTGGG + Intergenic
1182116108 22:27757427-27757449 TGCTAGAAGCTGCCGAGGCTGGG + Intronic
1185263156 22:49882149-49882171 TGACCCATGCTGACCAGGCTAGG + Intronic
954760498 3:52870442-52870464 TGACAGAGGCCGACCAGCCTGGG - Intronic
955496125 3:59534643-59534665 TGCCAGACACTGACCTGAGTGGG + Intergenic
956786616 3:72648091-72648113 TGACAGGGGCTGATCAGGCTGGG + Intergenic
961680198 3:128594768-128594790 GGCCCGATGCTGAGCAGGCTGGG - Intergenic
962396117 3:135016659-135016681 AGCCAGACCCTGGCCAGGGTGGG - Intronic
967100475 3:186211417-186211439 TCCCAGACTTTTACCAGGCTTGG + Intronic
967936548 3:194732752-194732774 AGCCAGACACTGACGAGGCTGGG - Intergenic
970660799 4:18283420-18283442 TGCCAGTCTCTGACCAGATTAGG - Intergenic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
973373347 4:49270933-49270955 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
973387661 4:49524275-49524297 TGCCAGACCCTGCCCCGGCCTGG - Intergenic
973788702 4:54358731-54358753 TGCCAGACTCTGACCATGGTGGG + Intergenic
982226269 4:153170397-153170419 AGCCTGAAGCTCACCAGGCTGGG - Intronic
984050707 4:174861682-174861704 TGTAAGACTTTGACCAGGCTGGG - Intronic
985223026 4:187728092-187728114 TGCCAGGTGCTGACCACACTCGG + Intergenic
986813649 5:11385126-11385148 TGGAAGGCGCTGCCCAGGCTGGG + Exonic
987074710 5:14370029-14370051 TGTCACATGCAGACCAGGCTGGG + Intronic
987741366 5:21913131-21913153 AACCAGAACCTGACCAGGCTTGG - Intronic
992967979 5:82022532-82022554 TGTCAGGAGCTGACCAGCCTGGG - Intronic
998138502 5:139687134-139687156 TGGCAGGCGCTGGGCAGGCTGGG - Intergenic
1004007447 6:11650154-11650176 TGCCATAGACTAACCAGGCTAGG - Intergenic
1005713537 6:28525259-28525281 TACCAGACGGAGCCCAGGCTGGG + Intronic
1005714258 6:28532034-28532056 TGCCAGACGCTCATCACGGTAGG - Intronic
1006716647 6:36124631-36124653 TTCCAGAGGCTGGCTAGGCTCGG + Intergenic
1007130131 6:39464607-39464629 TGCCAGGCGATGGCCTGGCTAGG - Intronic
1007174688 6:39887796-39887818 TGCCAGACGCTGACCAGGCTGGG - Intronic
1010474108 6:76264967-76264989 TGCCAGACCCTGTCCTGCCTTGG + Intergenic
1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG + Intergenic
1018393026 6:163355155-163355177 TGCCAGGGGCCGGCCAGGCTGGG - Intergenic
1020365565 7:7377493-7377515 AGGCAGACTCTGACCAGGCTGGG + Intronic
1024037181 7:45517062-45517084 TGCCATCCACTGGCCAGGCTAGG - Intergenic
1024283703 7:47739307-47739329 TGCCAGACATTTACCATGCTGGG - Intronic
1025248603 7:57336712-57336734 TGCCTGACGCTGAGCAACCTGGG + Intergenic
1029364153 7:100106603-100106625 GGCAAGAAGCTGACCACGCTGGG - Intronic
1029414248 7:100433098-100433120 TGCCATACGACGACCAGGGTTGG - Exonic
1034415378 7:150961841-150961863 TGGCAGATGCTGGCCAGGCTCGG + Intronic
1035157107 7:156923238-156923260 TGCCTGACGCAGACCAGACCAGG - Intergenic
1035157114 7:156923298-156923320 TGCCTGACGCAGACCAGACCAGG - Intergenic
1037805864 8:22057616-22057638 AGCCAGTGGCTGGCCAGGCTGGG + Intronic
1039110663 8:34037923-34037945 TGCCAAAAGCTGGCCAGGCATGG - Intergenic
1049542487 8:143214896-143214918 TGCTGGAGGCTCACCAGGCTAGG + Intergenic
1049603970 8:143520578-143520600 AGCCAGAAGCTTACAAGGCTGGG - Intronic
1049610592 8:143553102-143553124 TGCCAGACACTGTCCTGGCCTGG - Intergenic
1049633116 8:143670078-143670100 TCCCAGACGATGCCGAGGCTGGG + Intergenic
1056630632 9:88290363-88290385 TGCCAAACTCTGACCAGGCGTGG + Intergenic
1057028639 9:91756558-91756580 GGCCCGAGGCTGACCTGGCTGGG - Intronic
1057441016 9:95083208-95083230 TGCCAGCCGATGACCAGGCGTGG - Intronic
1059257281 9:112942760-112942782 AGCCTGACACTGACAAGGCTGGG + Intergenic
1061163589 9:128910030-128910052 TGCCAGTCTCTTACCTGGCTGGG + Intronic
1061442963 9:130619045-130619067 GGCCGGACGCTGAGCAGGGTGGG - Intronic
1062012661 9:134275392-134275414 AGGCAGACCCTGACCAGGGTAGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1203776094 EBV:73982-74004 GGCCAGGCTCTGACCAGACTCGG + Intergenic
1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
1203552153 Un_KI270743v1:172093-172115 TGCCAGACCCTGCCCCGGCCCGG - Intergenic
1192655611 X:72990457-72990479 TAACAGACGCTGGCAAGGCTGGG + Intergenic
1196556011 X:117085262-117085284 TGTCTGAAGCAGACCAGGCTTGG - Intergenic
1197945177 X:131830902-131830924 TGTTAGAGGCTGAGCAGGCTCGG - Intergenic