ID: 1007175823

View in Genome Browser
Species Human (GRCh38)
Location 6:39896776-39896798
Sequence CACAGGTCAGAGGCCTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007175823_1007175832 10 Left 1007175823 6:39896776-39896798 CCCATGCAGGCCTCTGACCTGTG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210
1007175823_1007175833 11 Left 1007175823 6:39896776-39896798 CCCATGCAGGCCTCTGACCTGTG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1007175833 6:39896810-39896832 AGCCATCCTGTTGGCCTCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 236
1007175823_1007175828 2 Left 1007175823 6:39896776-39896798 CCCATGCAGGCCTCTGACCTGTG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1007175828 6:39896801-39896823 TCCTCTCCCAGCCATCCTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 267
1007175823_1007175836 17 Left 1007175823 6:39896776-39896798 CCCATGCAGGCCTCTGACCTGTG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007175823 Original CRISPR CACAGGTCAGAGGCCTGCAT GGG (reversed) Intronic