ID: 1007175828

View in Genome Browser
Species Human (GRCh38)
Location 6:39896801-39896823
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 267}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007175825_1007175828 -8 Left 1007175825 6:39896786-39896808 CCTCTGACCTGTGCCTCCTCTCC 0: 1
1: 0
2: 12
3: 94
4: 913
Right 1007175828 6:39896801-39896823 TCCTCTCCCAGCCATCCTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 267
1007175821_1007175828 11 Left 1007175821 6:39896767-39896789 CCTGCCTAGCCCATGCAGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 286
Right 1007175828 6:39896801-39896823 TCCTCTCCCAGCCATCCTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 267
1007175824_1007175828 1 Left 1007175824 6:39896777-39896799 CCATGCAGGCCTCTGACCTGTGC 0: 1
1: 0
2: 2
3: 45
4: 448
Right 1007175828 6:39896801-39896823 TCCTCTCCCAGCCATCCTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 267
1007175822_1007175828 7 Left 1007175822 6:39896771-39896793 CCTAGCCCATGCAGGCCTCTGAC 0: 1
1: 0
2: 1
3: 29
4: 255
Right 1007175828 6:39896801-39896823 TCCTCTCCCAGCCATCCTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 267
1007175823_1007175828 2 Left 1007175823 6:39896776-39896798 CCCATGCAGGCCTCTGACCTGTG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1007175828 6:39896801-39896823 TCCTCTCCCAGCCATCCTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 267
1007175820_1007175828 12 Left 1007175820 6:39896766-39896788 CCCTGCCTAGCCCATGCAGGCCT 0: 1
1: 0
2: 2
3: 22
4: 330
Right 1007175828 6:39896801-39896823 TCCTCTCCCAGCCATCCTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type