ID: 1007175832

View in Genome Browser
Species Human (GRCh38)
Location 6:39896809-39896831
Sequence CAGCCATCCTGTTGGCCTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007175821_1007175832 19 Left 1007175821 6:39896767-39896789 CCTGCCTAGCCCATGCAGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 286
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210
1007175824_1007175832 9 Left 1007175824 6:39896777-39896799 CCATGCAGGCCTCTGACCTGTGC 0: 1
1: 0
2: 2
3: 45
4: 448
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210
1007175825_1007175832 0 Left 1007175825 6:39896786-39896808 CCTCTGACCTGTGCCTCCTCTCC 0: 1
1: 0
2: 12
3: 94
4: 913
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210
1007175823_1007175832 10 Left 1007175823 6:39896776-39896798 CCCATGCAGGCCTCTGACCTGTG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210
1007175822_1007175832 15 Left 1007175822 6:39896771-39896793 CCTAGCCCATGCAGGCCTCTGAC 0: 1
1: 0
2: 1
3: 29
4: 255
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210
1007175820_1007175832 20 Left 1007175820 6:39896766-39896788 CCCTGCCTAGCCCATGCAGGCCT 0: 1
1: 0
2: 2
3: 22
4: 330
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210
1007175826_1007175832 -7 Left 1007175826 6:39896793-39896815 CCTGTGCCTCCTCTCCCAGCCAT 0: 1
1: 0
2: 4
3: 67
4: 647
Right 1007175832 6:39896809-39896831 CAGCCATCCTGTTGGCCTCCCGG 0: 1
1: 0
2: 3
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007175832 Original CRISPR CAGCCATCCTGTTGGCCTCC CGG Exonic