ID: 1007175836

View in Genome Browser
Species Human (GRCh38)
Location 6:39896816-39896838
Sequence CCTGTTGGCCTCCCGGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 206}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007175822_1007175836 22 Left 1007175822 6:39896771-39896793 CCTAGCCCATGCAGGCCTCTGAC 0: 1
1: 0
2: 1
3: 29
4: 255
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175827_1007175836 -6 Left 1007175827 6:39896799-39896821 CCTCCTCTCCCAGCCATCCTGTT 0: 1
1: 0
2: 6
3: 91
4: 1033
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175821_1007175836 26 Left 1007175821 6:39896767-39896789 CCTGCCTAGCCCATGCAGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 286
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175820_1007175836 27 Left 1007175820 6:39896766-39896788 CCCTGCCTAGCCCATGCAGGCCT 0: 1
1: 0
2: 2
3: 22
4: 330
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175826_1007175836 0 Left 1007175826 6:39896793-39896815 CCTGTGCCTCCTCTCCCAGCCAT 0: 1
1: 0
2: 4
3: 67
4: 647
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175829_1007175836 -9 Left 1007175829 6:39896802-39896824 CCTCTCCCAGCCATCCTGTTGGC 0: 1
1: 0
2: 1
3: 35
4: 328
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175823_1007175836 17 Left 1007175823 6:39896776-39896798 CCCATGCAGGCCTCTGACCTGTG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175825_1007175836 7 Left 1007175825 6:39896786-39896808 CCTCTGACCTGTGCCTCCTCTCC 0: 1
1: 0
2: 12
3: 94
4: 913
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206
1007175824_1007175836 16 Left 1007175824 6:39896777-39896799 CCATGCAGGCCTCTGACCTGTGC 0: 1
1: 0
2: 2
3: 45
4: 448
Right 1007175836 6:39896816-39896838 CCTGTTGGCCTCCCGGGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007175836 Original CRISPR CCTGTTGGCCTCCCGGGAGC TGG Exonic