ID: 1007176803

View in Genome Browser
Species Human (GRCh38)
Location 6:39902737-39902759
Sequence CTGTGGATTAGTAGACAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007176803_1007176812 25 Left 1007176803 6:39902737-39902759 CCATCCTGTCTACTAATCCACAG 0: 1
1: 0
2: 0
3: 22
4: 135
Right 1007176812 6:39902785-39902807 CACAGCTATGGCTCACTACCAGG 0: 1
1: 0
2: 0
3: 12
4: 92
1007176803_1007176806 -3 Left 1007176803 6:39902737-39902759 CCATCCTGTCTACTAATCCACAG 0: 1
1: 0
2: 0
3: 22
4: 135
Right 1007176806 6:39902757-39902779 CAGTCCTAGAAGACTCACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 117
1007176803_1007176807 -2 Left 1007176803 6:39902737-39902759 CCATCCTGTCTACTAATCCACAG 0: 1
1: 0
2: 0
3: 22
4: 135
Right 1007176807 6:39902758-39902780 AGTCCTAGAAGACTCACCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 98
1007176803_1007176809 13 Left 1007176803 6:39902737-39902759 CCATCCTGTCTACTAATCCACAG 0: 1
1: 0
2: 0
3: 22
4: 135
Right 1007176809 6:39902773-39902795 ACCTTGGGTTTCCACAGCTATGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007176803 Original CRISPR CTGTGGATTAGTAGACAGGA TGG (reversed) Exonic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
902787811 1:18744639-18744661 GAATGGATGAGTAGACAGGACGG + Intronic
903404107 1:23081992-23082014 CTCTGGATTCATAGACAGGAAGG + Intronic
905162533 1:36049185-36049207 CTGTGGACTACTAGAGAGGAGGG + Intronic
906773107 1:48502768-48502790 CTGAGGATGAGTAGAGTGGATGG + Intergenic
906827460 1:48996850-48996872 ATATAGATAAGTAGACAGGAAGG - Intronic
907480178 1:54740337-54740359 CTTTGGCTTGGTAGGCAGGAAGG + Intronic
908098226 1:60762995-60763017 CTGAGGTTTAGAAGACAAGAAGG + Intergenic
908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG + Intronic
909193515 1:72586424-72586446 CTGTGGATTTGGTGACAGAAAGG + Intergenic
911363313 1:96906299-96906321 ATGTGGAGTAGTAGACAAGAGGG + Intergenic
912831962 1:112960769-112960791 CTGTGATGTAGTAGATAGGAAGG + Intergenic
916860578 1:168800276-168800298 CTGTGGATTCCTTGACAGAAGGG - Intergenic
917452458 1:175158311-175158333 CATTGGATTAGGAGACAGCAGGG + Intronic
920298313 1:204973448-204973470 CTGTGCAGTAGTGGAGAGGAGGG - Intronic
922675458 1:227546591-227546613 CTGATGATTGGTAGAGAGGAGGG + Intergenic
924554828 1:245109373-245109395 CTGGGGATTATTAAGCAGGAGGG - Intronic
1065502121 10:26392504-26392526 CTGTGGATGAACAGACAGGAAGG - Intergenic
1067735302 10:48845883-48845905 CTGTGGAGTGGTAGGCAAGAGGG + Intronic
1068528867 10:58162565-58162587 CTGAGGAGGAGTACACAGGAAGG - Intergenic
1070108902 10:73463298-73463320 CTGTGGTGAAGTAGACTGGAAGG - Intronic
1074160765 10:110834762-110834784 CACTGGATTAGGAGACAGAAGGG - Intronic
1075994766 10:126868400-126868422 CTGTAGAATAATAGAAAGGATGG + Intergenic
1079139534 11:17798859-17798881 CTGTGGATGAGGAAACAGGCTGG + Intronic
1079336075 11:19572001-19572023 CTGTGGATGAGTAGACTGGCAGG + Intronic
1083542168 11:63519583-63519605 CTGGGGACTACTAGACTGGAGGG + Intergenic
1087629285 11:100631564-100631586 CTGTGGAGCAGAAGACAGGAAGG + Intergenic
1089378639 11:118012374-118012396 CTGTAGTTTGGTAGACAGCAGGG - Intergenic
1092197919 12:6561132-6561154 ATGTGGATTCCTGGACAGGAGGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092905631 12:13098333-13098355 CTGTAGATTAGCAGGCAGGGAGG - Intronic
1093249852 12:16788920-16788942 CTCTGGTTTAATTGACAGGATGG + Intergenic
1095114670 12:38338190-38338212 CTGTGGATTAGAAGAGAGTCAGG + Intergenic
1101502851 12:105320216-105320238 CAGTGGATTCGTAGGCAGGAGGG + Intronic
1101684046 12:106999558-106999580 CTGTGGATTAGTTGGGAAGAAGG - Exonic
1105595166 13:21830632-21830654 CTGGGGACTACTAGAGAGGAGGG - Intergenic
1105917519 13:24930466-24930488 CTGGGGACTACTAGACAGGGAGG - Intergenic
1106190425 13:27448119-27448141 ATGTGGTTTAGTAGATATGAGGG + Intronic
1107814054 13:44228483-44228505 CTGTGGATGAATAGACAAGTAGG - Intergenic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1114525815 14:23366303-23366325 CTGGGGATTAAGAGAAAGGAGGG + Intergenic
1116237333 14:42296431-42296453 CTGTGGACTACTATAGAGGATGG + Intergenic
1116695980 14:48178914-48178936 AAGAGGATTAGTAGACATGATGG - Intergenic
1116751603 14:48892736-48892758 CTGTGGAGCACTAAACAGGAAGG + Intergenic
1117449365 14:55836216-55836238 CTGGGGATTAGTAGTCATCAGGG + Intergenic
1118127933 14:62929804-62929826 CTGTGGATTACTAGAGGGGGAGG - Intronic
1118603701 14:67488158-67488180 CTGTGGATGACCAGGCAGGATGG + Intronic
1125344734 15:38707641-38707663 CTGTGGATTACCAGAGAGGGAGG - Intergenic
1126497310 15:49306398-49306420 CTGTGTATTAGAAGTCAGTAAGG + Intronic
1126884215 15:53132291-53132313 CTCTGAATTAGTAGATAGGCAGG + Intergenic
1128282974 15:66412276-66412298 CTGTGGGCTGGTAGACAGAATGG + Intronic
1138147178 16:54623102-54623124 CTGAGGATTAGCAGGCAGAAGGG + Intergenic
1140704867 16:77618289-77618311 CTGTGGCTTAGTAGCCAGGTGGG - Intergenic
1143282906 17:5767950-5767972 CTGAGGTTTAGCAGACAGGTGGG - Intergenic
1148761122 17:50001148-50001170 CTGTGGATTTGTAGTCAGGGTGG + Intergenic
1151496980 17:74463759-74463781 CTTTGGGTTTGTGGACAGGATGG + Intergenic
1156015985 18:32547573-32547595 CTGTGGAGAAGAAAACAGGAGGG - Intergenic
1156332242 18:36133292-36133314 CAGTGGATTTGTAAACAGGATGG + Exonic
1156635227 18:39019955-39019977 CTGTGGATTAAATGACAGCAAGG - Intergenic
1156663861 18:39381913-39381935 ATGTGGATAATTAGACAAGAGGG + Intergenic
1158426745 18:57347214-57347236 GTGTGGATTAGCAGAAAGGGTGG + Intergenic
1158798251 18:60874760-60874782 CTGTTAAATAGTAAACAGGATGG + Intergenic
1162220952 19:9175837-9175859 GGATGGATTAGAAGACAGGAGGG - Intergenic
1164922661 19:32101056-32101078 CTGAGGATTACTAGAGGGGAGGG - Intergenic
1165449957 19:35876494-35876516 CTGTGGGTGAGTGGACATGAAGG - Intronic
1165911051 19:39227799-39227821 TTGTGGATTGGAAGACTGGACGG + Intergenic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1167176989 19:47871757-47871779 CTGAGGAATTGTACACAGGATGG - Intronic
925694157 2:6557067-6557089 TTGTAGATTAGAAGACAGGAAGG - Intergenic
927089043 2:19696553-19696575 CTGTGGATGAGAAGACAGCCTGG + Intergenic
927361505 2:22240049-22240071 ATCTAGATTAGTAAACAGGAAGG - Intergenic
927443431 2:23136646-23136668 CTGAGAATTAGTAGCCATGATGG - Intergenic
930363923 2:50415088-50415110 CTGTGGAATGGTACATAGGAAGG + Intronic
932008202 2:67948688-67948710 CTTTAGATTAGAAGACATGAAGG + Intergenic
932923930 2:75948209-75948231 CTGTGGAATAGTGTACAGGACGG + Intergenic
934743825 2:96745309-96745331 CTTTGGTTTGGAAGACAGGAAGG - Intergenic
937120675 2:119438210-119438232 CTGTGTATTAGCAGTCAGGTGGG - Exonic
937309424 2:120892964-120892986 CTGTGGATTTGAAGTCAGGAAGG + Intronic
937447494 2:121971218-121971240 CTGAGGGTGAGTAGCCAGGAGGG - Intergenic
939626586 2:144484675-144484697 CAGTGGAGGAGAAGACAGGAAGG - Intronic
940965160 2:159828991-159829013 CTGAGGACTAGGAGACAGGGAGG + Intronic
943850803 2:192720177-192720199 CTGGGGATTATTAGACAGAAAGG + Intergenic
944145368 2:196502624-196502646 CTGAGGAGTAGTAGAAGGGAGGG - Intronic
945127711 2:206531261-206531283 ATCTGGATTAGAAGACTGGATGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1173040247 20:39455371-39455393 CTGTGAATTAGAGGACAGGCTGG - Intergenic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182411057 22:30186848-30186870 CTGTGGTTTAGGAGACAATAAGG + Intergenic
949094854 3:74132-74154 CTGTAAATGAGTAGCCAGGAAGG + Intergenic
949509546 3:4756179-4756201 CTGGGGATTACTTGAGAGGAGGG + Intronic
951508505 3:23475983-23476005 TTGTGGATTAGTATTCAAGATGG + Intronic
953589745 3:44240425-44240447 CTGTGTGTTCGCAGACAGGAAGG + Intergenic
953736733 3:45500477-45500499 CTGTGGATTTGTACATTGGAGGG + Exonic
956903339 3:73740004-73740026 CTGTGGAGTAGGAGACAGTATGG + Intergenic
959297486 3:104555501-104555523 CTGTGGATTAGTTGCCAAGCAGG - Intergenic
960788484 3:121400047-121400069 CTGTGCATCAGTAGACAAAAGGG - Intronic
962912402 3:139864967-139864989 CTGGAGATGAGTAGGCAGGAGGG - Intergenic
962951104 3:140219683-140219705 CTGTGGAATTGGAGACAGCAGGG + Intronic
963429578 3:145181403-145181425 TTCTGGGTCAGTAGACAGGATGG + Intergenic
966028725 3:175319194-175319216 CAGTGTTTTAGTAGAAAGGAGGG - Intronic
967376899 3:188814224-188814246 CTGTCACTTAGTAGACAAGAAGG + Intronic
967386190 3:188913445-188913467 CTGTGGACTACTAAACAGGTAGG + Intergenic
969106650 4:4811557-4811579 GTGTGGATGAGAAGACAGGGAGG - Intergenic
969206520 4:5651333-5651355 AGGTGGATGAGTAGATAGGATGG + Intronic
972285675 4:37645581-37645603 CTGCATATTAGAAGACAGGAGGG + Intronic
972657236 4:41076257-41076279 GTTTGGATGAGAAGACAGGATGG + Intronic
973718954 4:53704354-53704376 CTGTGGACTACTAGACAGTGGGG - Intronic
975280389 4:72555468-72555490 CTGTGGATAAGTTGCCAAGAAGG - Intronic
980967996 4:139542233-139542255 CTGGGGAGTAGAAGGCAGGAGGG + Intronic
982435973 4:155383662-155383684 CTGGGGATTACTAGAAAGCAGGG - Intergenic
983956550 4:173704995-173705017 CTGGGGATCACTAGACGGGAGGG - Intergenic
990195534 5:53310961-53310983 CTGAGGATTACTTGCCAGGAAGG - Intergenic
990547239 5:56835272-56835294 CTGCAGGTTAGGAGACAGGAAGG + Intronic
991732751 5:69604987-69605009 ATATGGACTAGTAGTCAGGAAGG + Intergenic
991809184 5:70460131-70460153 ATATGGACTAGTAGTCAGGAAGG + Intergenic
991862202 5:71022865-71022887 ATATGGACTAGTAGTCAGGAAGG - Intronic
992204505 5:74417909-74417931 CTGGGCATTGGAAGACAGGAAGG - Intergenic
996022872 5:118611119-118611141 CTTGGGATTAGGAGGCAGGAGGG - Intergenic
1004386643 6:15178799-15178821 CTGTGTTTTAGTAGAGAGGAGGG - Intergenic
1004624352 6:17360833-17360855 CTGGGGACTACTAGACAGGGAGG + Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007767757 6:44171033-44171055 CTGTGGCTCAGTAGGCTGGAGGG + Intronic
1008770163 6:54968600-54968622 CTGTTGATTAGAAGGCAGGAGGG + Intergenic
1009951098 6:70397274-70397296 GTGTGAATTTGTATACAGGAAGG - Intergenic
1010891577 6:81318902-81318924 CTGTGGACTACTAGAGGGGAAGG + Intergenic
1016073083 6:139764043-139764065 CTGTGGAGGAGTAGGCTGGAAGG - Intergenic
1016871624 6:148823450-148823472 CTGTGGCTTAAAACACAGGAGGG - Intronic
1018914028 6:168121809-168121831 ATCTGGATTAATAGACAGGAAGG + Intergenic
1021622637 7:22563650-22563672 CCCTGGCTTAGGAGACAGGAAGG - Intronic
1023309652 7:38871385-38871407 CTGTGGATTAATGGAAATGATGG + Intronic
1024435743 7:49352965-49352987 CTCTGGATCAGTAGATAGGATGG + Intergenic
1025621532 7:63176076-63176098 CAGTGGACTAGTATGCAGGAAGG - Intergenic
1027942293 7:84698549-84698571 CTGTGGATAAATACACATGATGG + Intergenic
1030351571 7:108494367-108494389 CTGGGGACCATTAGACAGGAGGG - Intronic
1031245776 7:119309560-119309582 CTGGGGACTACTAGAGAGGAAGG + Intergenic
1031631555 7:124049143-124049165 CAGTGGATCAGCAAACAGGAAGG - Intergenic
1033789170 7:144770631-144770653 CTATGGATTAGTAATCAGGAAGG - Intronic
1035517672 8:250166-250188 CTCTGGGTCAGTAAACAGGATGG + Intergenic
1039473280 8:37826756-37826778 CTCTGGATTACTGGGCAGGAGGG - Intronic
1039870661 8:41542449-41542471 ATGGGGTTTAGTAGCCAGGATGG - Exonic
1040829864 8:51664636-51664658 CTGAGCAGTAGGAGACAGGAAGG - Intronic
1045705576 8:104918702-104918724 CAGTGGATTGGTAGGCAGCAGGG + Intronic
1048450609 8:134530045-134530067 CTGTGGCATAGCAGGCAGGAGGG + Intronic
1050991964 9:12167032-12167054 CTCTGGATCAGAAGGCAGGATGG + Intergenic
1051371711 9:16364717-16364739 CTGTGGCCTGGTAGGCAGGAGGG - Intergenic
1057832490 9:98417950-98417972 CTTTGGAGGAGTAGAAAGGAGGG + Intronic
1061255279 9:129451595-129451617 CTGTGAATGTGAAGACAGGAAGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188371198 X:29371596-29371618 CTGTGGATTACTAGAGGGAAAGG - Intronic
1188404746 X:29793941-29793963 CTGTGGATTAGCTAACAGTAGGG + Intronic
1188718596 X:33495389-33495411 CTGTGGAATACTATACAGCAAGG + Intergenic
1191603423 X:63035432-63035454 CAGTGGATTAGTAGACATTGGGG - Intergenic
1191611165 X:63114920-63114942 CAGTGGATCAGTGGACTGGAAGG - Intergenic
1194068563 X:89292061-89292083 CTGTGGACTACTAGACGGGGAGG + Intergenic
1195305211 X:103575177-103575199 ATGTGGTTTTGTAGACAGGAGGG + Intergenic