ID: 1007179967

View in Genome Browser
Species Human (GRCh38)
Location 6:39922914-39922936
Sequence CTGGTGGAGGAAGGAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 923
Summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 830}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179967_1007179976 2 Left 1007179967 6:39922914-39922936 CCCATCCCTCCTTCCTCCACCAG 0: 1
1: 0
2: 7
3: 85
4: 830
Right 1007179976 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data
1007179967_1007179982 30 Left 1007179967 6:39922914-39922936 CCCATCCCTCCTTCCTCCACCAG 0: 1
1: 0
2: 7
3: 85
4: 830
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179967 Original CRISPR CTGGTGGAGGAAGGAGGGAT GGG (reversed) Intronic