ID: 1007179969

View in Genome Browser
Species Human (GRCh38)
Location 6:39922919-39922941
Sequence GGGTGCTGGTGGAGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179969_1007179983 26 Left 1007179969 6:39922919-39922941 CCCTCCTTCCTCCACCAGCACCC No data
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179969_1007179976 -3 Left 1007179969 6:39922919-39922941 CCCTCCTTCCTCCACCAGCACCC No data
Right 1007179976 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data
1007179969_1007179984 27 Left 1007179969 6:39922919-39922941 CCCTCCTTCCTCCACCAGCACCC No data
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255
1007179969_1007179982 25 Left 1007179969 6:39922919-39922941 CCCTCCTTCCTCCACCAGCACCC No data
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179969 Original CRISPR GGGTGCTGGTGGAGGAAGGA GGG (reversed) Intronic