ID: 1007179970

View in Genome Browser
Species Human (GRCh38)
Location 6:39922920-39922942
Sequence TGGGTGCTGGTGGAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1190
Summary {0: 1, 1: 1, 2: 11, 3: 137, 4: 1040}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179970_1007179984 26 Left 1007179970 6:39922920-39922942 CCTCCTTCCTCCACCAGCACCCA 0: 1
1: 1
2: 11
3: 137
4: 1040
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255
1007179970_1007179983 25 Left 1007179970 6:39922920-39922942 CCTCCTTCCTCCACCAGCACCCA 0: 1
1: 1
2: 11
3: 137
4: 1040
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179970_1007179982 24 Left 1007179970 6:39922920-39922942 CCTCCTTCCTCCACCAGCACCCA 0: 1
1: 1
2: 11
3: 137
4: 1040
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179970_1007179976 -4 Left 1007179970 6:39922920-39922942 CCTCCTTCCTCCACCAGCACCCA 0: 1
1: 1
2: 11
3: 137
4: 1040
Right 1007179976 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179970 Original CRISPR TGGGTGCTGGTGGAGGAAGG AGG (reversed) Intronic