ID: 1007179972

View in Genome Browser
Species Human (GRCh38)
Location 6:39922927-39922949
Sequence GGGCAGATGGGTGCTGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 701}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179972_1007179984 19 Left 1007179972 6:39922927-39922949 CCTCCACCAGCACCCATCTGCCC 0: 1
1: 0
2: 7
3: 78
4: 701
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255
1007179972_1007179982 17 Left 1007179972 6:39922927-39922949 CCTCCACCAGCACCCATCTGCCC 0: 1
1: 0
2: 7
3: 78
4: 701
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179972_1007179983 18 Left 1007179972 6:39922927-39922949 CCTCCACCAGCACCCATCTGCCC 0: 1
1: 0
2: 7
3: 78
4: 701
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179972_1007179985 30 Left 1007179972 6:39922927-39922949 CCTCCACCAGCACCCATCTGCCC 0: 1
1: 0
2: 7
3: 78
4: 701
Right 1007179985 6:39922980-39923002 GCTCCTCTGGGGAAGATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179972 Original CRISPR GGGCAGATGGGTGCTGGTGG AGG (reversed) Intronic