ID: 1007179973

View in Genome Browser
Species Human (GRCh38)
Location 6:39922930-39922952
Sequence GCAGGGCAGATGGGTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 606}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179973_1007179985 27 Left 1007179973 6:39922930-39922952 CCACCAGCACCCATCTGCCCTGC 0: 1
1: 0
2: 5
3: 46
4: 606
Right 1007179985 6:39922980-39923002 GCTCCTCTGGGGAAGATCAGAGG No data
1007179973_1007179984 16 Left 1007179973 6:39922930-39922952 CCACCAGCACCCATCTGCCCTGC 0: 1
1: 0
2: 5
3: 46
4: 606
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255
1007179973_1007179983 15 Left 1007179973 6:39922930-39922952 CCACCAGCACCCATCTGCCCTGC 0: 1
1: 0
2: 5
3: 46
4: 606
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179973_1007179982 14 Left 1007179973 6:39922930-39922952 CCACCAGCACCCATCTGCCCTGC 0: 1
1: 0
2: 5
3: 46
4: 606
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179973 Original CRISPR GCAGGGCAGATGGGTGCTGG TGG (reversed) Intronic