ID: 1007179975

View in Genome Browser
Species Human (GRCh38)
Location 6:39922939-39922961
Sequence CCTTGAAGGGCAGGGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179975_1007179982 5 Left 1007179975 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179975_1007179983 6 Left 1007179975 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179975_1007179985 18 Left 1007179975 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data
Right 1007179985 6:39922980-39923002 GCTCCTCTGGGGAAGATCAGAGG No data
1007179975_1007179984 7 Left 1007179975 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179975 Original CRISPR CCTTGAAGGGCAGGGCAGAT GGG (reversed) Intronic