ID: 1007179977

View in Genome Browser
Species Human (GRCh38)
Location 6:39922940-39922962
Sequence GCCTTGAAGGGCAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 458}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179977_1007179983 5 Left 1007179977 6:39922940-39922962 CCATCTGCCCTGCCCTTCAAGGC 0: 1
1: 0
2: 4
3: 46
4: 458
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179977_1007179985 17 Left 1007179977 6:39922940-39922962 CCATCTGCCCTGCCCTTCAAGGC 0: 1
1: 0
2: 4
3: 46
4: 458
Right 1007179985 6:39922980-39923002 GCTCCTCTGGGGAAGATCAGAGG No data
1007179977_1007179987 30 Left 1007179977 6:39922940-39922962 CCATCTGCCCTGCCCTTCAAGGC 0: 1
1: 0
2: 4
3: 46
4: 458
Right 1007179987 6:39922993-39923015 AGATCAGAGGCTAGCCCCTGAGG No data
1007179977_1007179984 6 Left 1007179977 6:39922940-39922962 CCATCTGCCCTGCCCTTCAAGGC 0: 1
1: 0
2: 4
3: 46
4: 458
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255
1007179977_1007179982 4 Left 1007179977 6:39922940-39922962 CCATCTGCCCTGCCCTTCAAGGC 0: 1
1: 0
2: 4
3: 46
4: 458
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179977 Original CRISPR GCCTTGAAGGGCAGGGCAGA TGG (reversed) Intronic