ID: 1007179979

View in Genome Browser
Species Human (GRCh38)
Location 6:39922948-39922970
Sequence GCAAAGCAGCCTTGAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179979_1007179983 -3 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179979_1007179985 9 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179985 6:39922980-39923002 GCTCCTCTGGGGAAGATCAGAGG No data
1007179979_1007179984 -2 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255
1007179979_1007179987 22 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179987 6:39922993-39923015 AGATCAGAGGCTAGCCCCTGAGG No data
1007179979_1007179988 23 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179988 6:39922994-39923016 GATCAGAGGCTAGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1007179979_1007179982 -4 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179979 Original CRISPR GCAAAGCAGCCTTGAAGGGC AGG (reversed) Intronic