ID: 1007179980

View in Genome Browser
Species Human (GRCh38)
Location 6:39922952-39922974
Sequence CAGAGCAAAGCAGCCTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179980_1007179983 -7 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179983 6:39922968-39922990 TGCTCTGAAGCAGCTCCTCTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
1007179980_1007179982 -8 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179980_1007179984 -6 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179984 6:39922969-39922991 GCTCTGAAGCAGCTCCTCTGGGG 0: 1
1: 0
2: 7
3: 26
4: 255
1007179980_1007179985 5 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179985 6:39922980-39923002 GCTCCTCTGGGGAAGATCAGAGG No data
1007179980_1007179987 18 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179987 6:39922993-39923015 AGATCAGAGGCTAGCCCCTGAGG No data
1007179980_1007179988 19 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179988 6:39922994-39923016 GATCAGAGGCTAGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179980 Original CRISPR CAGAGCAAAGCAGCCTTGAA GGG (reversed) Intronic