ID: 1007179982

View in Genome Browser
Species Human (GRCh38)
Location 6:39922967-39922989
Sequence TTGCTCTGAAGCAGCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 185}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179975_1007179982 5 Left 1007179975 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG No data
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179981_1007179982 -9 Left 1007179981 6:39922953-39922975 CCTTCAAGGCTGCTTTGCTCTGA 0: 1
1: 0
2: 2
3: 22
4: 223
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179970_1007179982 24 Left 1007179970 6:39922920-39922942 CCTCCTTCCTCCACCAGCACCCA 0: 1
1: 1
2: 11
3: 137
4: 1040
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179978_1007179982 -3 Left 1007179978 6:39922947-39922969 CCCTGCCCTTCAAGGCTGCTTTG 0: 1
1: 0
2: 0
3: 26
4: 247
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179974_1007179982 11 Left 1007179974 6:39922933-39922955 CCAGCACCCATCTGCCCTGCCCT No data
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179980_1007179982 -8 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179973_1007179982 14 Left 1007179973 6:39922930-39922952 CCACCAGCACCCATCTGCCCTGC 0: 1
1: 0
2: 5
3: 46
4: 606
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179971_1007179982 21 Left 1007179971 6:39922923-39922945 CCTTCCTCCACCAGCACCCATCT 0: 1
1: 1
2: 5
3: 78
4: 652
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179968_1007179982 29 Left 1007179968 6:39922915-39922937 CCATCCCTCCTTCCTCCACCAGC 0: 1
1: 2
2: 15
3: 241
4: 2049
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179979_1007179982 -4 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179977_1007179982 4 Left 1007179977 6:39922940-39922962 CCATCTGCCCTGCCCTTCAAGGC 0: 1
1: 0
2: 4
3: 46
4: 458
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179972_1007179982 17 Left 1007179972 6:39922927-39922949 CCTCCACCAGCACCCATCTGCCC 0: 1
1: 0
2: 7
3: 78
4: 701
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179969_1007179982 25 Left 1007179969 6:39922919-39922941 CCCTCCTTCCTCCACCAGCACCC No data
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179967_1007179982 30 Left 1007179967 6:39922914-39922936 CCCATCCCTCCTTCCTCCACCAG 0: 1
1: 0
2: 7
3: 85
4: 830
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179982 Original CRISPR TTGCTCTGAAGCAGCTCCTC TGG Intronic