ID: 1007179982

View in Genome Browser
Species Human (GRCh38)
Location 6:39922967-39922989
Sequence TTGCTCTGAAGCAGCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 185}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007179980_1007179982 -8 Left 1007179980 6:39922952-39922974 CCCTTCAAGGCTGCTTTGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179974_1007179982 11 Left 1007179974 6:39922933-39922955 CCAGCACCCATCTGCCCTGCCCT 0: 1
1: 0
2: 2
3: 62
4: 689
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179970_1007179982 24 Left 1007179970 6:39922920-39922942 CCTCCTTCCTCCACCAGCACCCA 0: 1
1: 1
2: 11
3: 137
4: 1040
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179973_1007179982 14 Left 1007179973 6:39922930-39922952 CCACCAGCACCCATCTGCCCTGC 0: 1
1: 0
2: 5
3: 46
4: 606
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179967_1007179982 30 Left 1007179967 6:39922914-39922936 CCCATCCCTCCTTCCTCCACCAG 0: 1
1: 0
2: 7
3: 85
4: 830
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179975_1007179982 5 Left 1007179975 6:39922939-39922961 CCCATCTGCCCTGCCCTTCAAGG 0: 1
1: 0
2: 1
3: 28
4: 266
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179971_1007179982 21 Left 1007179971 6:39922923-39922945 CCTTCCTCCACCAGCACCCATCT 0: 1
1: 1
2: 5
3: 78
4: 652
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179981_1007179982 -9 Left 1007179981 6:39922953-39922975 CCTTCAAGGCTGCTTTGCTCTGA 0: 1
1: 0
2: 2
3: 22
4: 223
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179979_1007179982 -4 Left 1007179979 6:39922948-39922970 CCTGCCCTTCAAGGCTGCTTTGC 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179968_1007179982 29 Left 1007179968 6:39922915-39922937 CCATCCCTCCTTCCTCCACCAGC 0: 1
1: 2
2: 15
3: 241
4: 2049
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179972_1007179982 17 Left 1007179972 6:39922927-39922949 CCTCCACCAGCACCCATCTGCCC 0: 1
1: 0
2: 7
3: 78
4: 701
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179978_1007179982 -3 Left 1007179978 6:39922947-39922969 CCCTGCCCTTCAAGGCTGCTTTG 0: 1
1: 0
2: 0
3: 26
4: 247
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179977_1007179982 4 Left 1007179977 6:39922940-39922962 CCATCTGCCCTGCCCTTCAAGGC 0: 1
1: 0
2: 4
3: 46
4: 458
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185
1007179969_1007179982 25 Left 1007179969 6:39922919-39922941 CCCTCCTTCCTCCACCAGCACCC 0: 1
1: 1
2: 15
3: 148
4: 1096
Right 1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007179982 Original CRISPR TTGCTCTGAAGCAGCTCCTC TGG Intronic
900807469 1:4776775-4776797 TGGTCCTGAAACAGCTCCTCAGG - Intronic
901637669 1:10677870-10677892 TGGCTCTGAACCAGCACCTGCGG + Intronic
902629160 1:17694657-17694679 TGGCTCTGCTGCAGCCCCTCAGG - Intronic
904267695 1:29327018-29327040 GGCCTCTGAAGCAGTTCCTCAGG + Intergenic
904791902 1:33028862-33028884 TGGCTCTCAAGCAGCACCTCAGG + Intronic
905295812 1:36953834-36953856 TGGCCCTGAAGAAGCTCCCCTGG + Intronic
906598199 1:47099111-47099133 TTTCTCTGAAGCAGATCTCCAGG + Exonic
907377213 1:54053621-54053643 TTCCTCTGAAGAAACTCCGCCGG - Exonic
908006588 1:59734699-59734721 GTGCCCTGAAGCAGCCCCTGGGG + Intronic
908642855 1:66244668-66244690 TTGCTTTGAAGCAGTGCCCCAGG + Intronic
910177845 1:84450327-84450349 TTGCTCTGAGGCTGCTTCTTAGG - Intergenic
910653263 1:89592783-89592805 TTGCACTGAAACAGCCCATCTGG - Exonic
918038327 1:180896731-180896753 TTGCTGTGAAGTTGATCCTCTGG - Intergenic
919067375 1:192709747-192709769 TTACTCAAAAGCACCTCCTCTGG - Intergenic
919317995 1:195999577-195999599 TTGGTCTCAAGCAGGTCCTGAGG + Intergenic
920760073 1:208775056-208775078 CCGCTCTGAACCAGCTCTTCTGG - Intergenic
922563939 1:226589086-226589108 TTACTCTGAAGCAGCTGCTTCGG + Intronic
922598562 1:226832853-226832875 TTGCTCTGAGGGGGCTCCTCTGG - Intergenic
923497681 1:234539493-234539515 TTGCTCTGAAGCAACAACACAGG + Intergenic
924843009 1:247734289-247734311 TTCCTCTGAATCTTCTCCTCGGG - Intergenic
1066496790 10:35949969-35949991 CTGCTCAGAGACAGCTCCTCTGG + Intergenic
1067053699 10:43039464-43039486 TGGCTGTGCGGCAGCTCCTCTGG - Intergenic
1067782791 10:49221221-49221243 CTGCTCTGATGGAGTTCCTCAGG - Intergenic
1069846586 10:71376387-71376409 TTGCTCTGACACAGCTCTACAGG - Intergenic
1071277198 10:84066085-84066107 TGGCCCTGAGGCAGTTCCTCAGG + Intergenic
1071789595 10:88940101-88940123 TTATGCTGAATCAGCTCCTCAGG + Intronic
1073129875 10:101181182-101181204 TTCCTCTAAAGCAGCTTCTACGG + Intergenic
1074252658 10:111767606-111767628 TTGCTATAAAGCAGCCACTCTGG + Intergenic
1075762837 10:124869934-124869956 CTGCTCTGAAACTGCTGCTCTGG + Intergenic
1076689020 10:132211460-132211482 TGGTTCTGGAGCAGCTCCTCAGG - Intronic
1077027219 11:446238-446260 CTGCTCAGAGGCAGCCCCTCTGG + Intergenic
1077097242 11:804323-804345 ATCCTCTGAAGCATCTCCTGCGG + Exonic
1077993780 11:7435281-7435303 TTGCTCTCAAGCATCTCCTCTGG - Intronic
1080026299 11:27618839-27618861 TTTCTCTGACTCAGATCCTCAGG + Intergenic
1084331876 11:68435294-68435316 TTGCTATGAAGGAGCACCTGAGG + Intronic
1084517482 11:69644573-69644595 GTGCTCTGAAGCGCCCCCTCAGG - Intronic
1085119935 11:73960637-73960659 TTCCTCAGAAGCAGCTACTAGGG + Intronic
1087786534 11:102361149-102361171 TGGCTCTGTAGCTGCTCCACAGG - Intronic
1093910794 12:24744565-24744587 ATGGTGGGAAGCAGCTCCTCTGG + Intergenic
1096081709 12:48837646-48837668 TTGGTCTGCAGAAGATCCTCAGG - Exonic
1096629470 12:52916604-52916626 TTACTCTGGAGCATCTACTCTGG - Intronic
1096679687 12:53247312-53247334 TTGCTCAGAAGCACCTACTAGGG - Intergenic
1097484079 12:60171535-60171557 TTTCTCTGAAACACCTCTTCGGG - Intergenic
1100351806 12:93791028-93791050 TTTCTCTGCAACAGCTCCTGTGG - Intronic
1100383078 12:94080026-94080048 TTGCTCTGAACAAGCTGCCCTGG + Intergenic
1104156363 12:126136683-126136705 TTGGGCTGAAGCAGGACCTCTGG + Intergenic
1105509656 13:21040690-21040712 TGGCTCTGCTGCAGCTCCTGGGG - Intronic
1108046279 13:46387331-46387353 TAGCTCTCTAGAAGCTCCTCAGG + Exonic
1110130403 13:72001836-72001858 TGGCTCTGAAGTAGCTCCTTAGG - Intergenic
1111371953 13:87331404-87331426 TTGCTCTGGCGCAGCTCTCCAGG - Intergenic
1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG + Intronic
1114369122 14:22066066-22066088 TGTCTCTGAAGGAGCCCCTCTGG + Intergenic
1114374800 14:22132780-22132802 TGTCTCTGAAGAAGCCCCTCTGG + Intergenic
1115465127 14:33706809-33706831 AGGCTCTGAATCAGCTGCTCAGG - Intronic
1118877235 14:69795998-69796020 CAGGTCTGAAGTAGCTCCTCTGG + Intronic
1121220526 14:92281472-92281494 TTGTTCTTCAGCATCTCCTCAGG + Intergenic
1125635454 15:41184553-41184575 TTGAGTTGAAGCAGTTCCTCTGG + Exonic
1127383657 15:58450400-58450422 TTGTTCTGAGGCAGTTCTTCAGG - Intronic
1132006859 15:98235160-98235182 TTGCTCTGCACCAGAACCTCAGG - Intergenic
1132538778 16:497542-497564 TTCCTCTGGAGCATCCCCTCTGG + Intronic
1132898930 16:2243084-2243106 GTGCTCTGCACCTGCTCCTCCGG + Exonic
1135566238 16:23513296-23513318 TTGCTCTGAGGCTGCTTCTGAGG - Intronic
1141196560 16:81865551-81865573 TTGTTCTTGAGCAGCTGCTCTGG + Intronic
1141423355 16:83931142-83931164 GTCCTCTGCTGCAGCTCCTCCGG - Intronic
1141485225 16:84334355-84334377 TGGCTCTGAGGCAGCATCTCTGG + Intergenic
1142679718 17:1539575-1539597 TTGCTCGGGCCCAGCTCCTCAGG - Intronic
1142772345 17:2107600-2107622 TTGGGCTGGGGCAGCTCCTCTGG + Intronic
1144163041 17:12580570-12580592 TAACTATGAAGCAGCTCCTCAGG + Intergenic
1144469474 17:15524678-15524700 TTTCTCAGAAGCAGCTGCTGGGG + Intronic
1146754014 17:35410035-35410057 GTGCACTGAAGGAGCTCCACTGG - Intergenic
1148876910 17:50693598-50693620 ATGCCCTGCAGCTGCTCCTCTGG + Exonic
1149425698 17:56552199-56552221 TTGATCTGTAGCCGCTTCTCTGG - Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1150524776 17:65910954-65910976 TTGGTCTTAAACAGCTTCTCTGG - Intronic
1150719972 17:67606045-67606067 CTGCTCAGAAGCAGATCCTGGGG + Intronic
1152499630 17:80699168-80699190 TTTCTCTGGAGAAGCTCATCGGG + Intronic
1152946453 17:83200250-83200272 TTTTTCTGAGCCAGCTCCTCTGG - Intergenic
1156268574 18:35510510-35510532 TTATTCTGCAGCAGCTCCACTGG + Intergenic
1156674581 18:39512407-39512429 TTGCTGAGAAGCAGCTTCCCTGG + Intergenic
1156808517 18:41218033-41218055 TTGCTCTGATGCTGCTATTCTGG - Intergenic
1159405454 18:67996586-67996608 TTGCTGTGAAGCTGCTTCTGAGG - Intergenic
1159609086 18:70506931-70506953 GTGCACTGAAACAGTTCCTCAGG - Intergenic
1159658469 18:71061970-71061992 CTGCACTGAAGCAGCTCACCAGG - Intergenic
1163263915 19:16207050-16207072 TTGATCTAAAGCAGCCTCTCTGG + Intronic
1164703363 19:30302226-30302248 TTGCTCTGCTGCAAGTCCTCGGG + Intronic
1166045399 19:40226850-40226872 CTGCCCGGAAGCAGCCCCTCTGG + Intergenic
1166441960 19:42823188-42823210 TTTCTCTGAATCTGCTCCTGGGG - Intronic
1168548214 19:57271486-57271508 TTAATCTAAAGTAGCTCCTCCGG - Intergenic
925860781 2:8173233-8173255 TTGCTCTTCAGCAGAGCCTCCGG + Intergenic
927128343 2:20034316-20034338 TGCCTTTGAAGCACCTCCTCAGG - Exonic
928370242 2:30735332-30735354 TTGCTTTGGAGTAGCTCCTGGGG - Intronic
930866547 2:56127556-56127578 CCTCTCTGAAGCAGCTACTCAGG - Intergenic
932039585 2:68285121-68285143 TTGCTCAAGAGCAGCTCCTGGGG + Intronic
934164334 2:89280610-89280632 TGGCTCAGAAGCAGCTCCCCTGG - Intergenic
934202940 2:89901914-89901936 TGGCTCAGAAGCAGCTCCCCTGG + Intergenic
934572190 2:95379744-95379766 CTGCTCTGCAGCAGCGCCTGAGG - Intronic
934576624 2:95405822-95405844 TCGCCCTGAAGCAGCTGCCCTGG + Intronic
934794805 2:97091421-97091443 TCGCCCTGAAGCAGCTGCCCTGG - Intronic
936849958 2:116883876-116883898 TTGTTCTGAAGCATCTCTTCAGG - Intergenic
937703436 2:124890549-124890571 TTGCTCTGAAGCAGATACCAAGG - Intronic
939106488 2:137954431-137954453 TGGGTCTGAAGCAACTCCCCAGG - Intergenic
939785114 2:146499958-146499980 TGGGTCTGAAGAAACTCCTCAGG + Intergenic
941120435 2:161523646-161523668 TTAATCTGAAGCAGCTTCCCAGG - Intronic
941378846 2:164766072-164766094 TTCCACTGAAGCAGCTCTTGAGG + Intronic
946042859 2:216797435-216797457 TTGCTATGATGCTGCTCCTGAGG + Intergenic
947408374 2:229805871-229805893 TTGCTCTCAGGCAGCCCATCAGG - Intronic
947591990 2:231391108-231391130 TTGGTAAGAAGCACCTCCTCTGG + Intergenic
948790651 2:240374848-240374870 AAACCCTGAAGCAGCTCCTCTGG + Intergenic
1168971258 20:1932481-1932503 CTGCTCTGCTCCAGCTCCTCTGG - Intronic
1169220849 20:3821745-3821767 TCGGTCTGGAGCAGCTCCTCAGG + Intronic
1169419167 20:5445517-5445539 TAGCTCAGAAGCAGCTCAGCTGG + Intergenic
1170383286 20:15785684-15785706 TTTCCCTGAGGCAGGTCCTCAGG + Intronic
1170384725 20:15803879-15803901 TTGCTCTTAAGCACCTACTCTGG + Intronic
1170866051 20:20159380-20159402 TTCCTCGGATGCAGCTTCTCTGG - Exonic
1172013560 20:31860521-31860543 TAGTTAGGAAGCAGCTCCTCTGG - Intronic
1172760453 20:37317645-37317667 TTGCCCTGAATCAGCTGCTGAGG + Intergenic
1173732331 20:45337662-45337684 TGGCTCTGAAGCAGCTTTCCTGG - Intronic
1174068659 20:47884583-47884605 TTGCTCTGAATGCCCTCCTCAGG + Intergenic
1174186626 20:48710869-48710891 TTGCTCTGCTGCAGCTCCGCTGG - Intronic
1174583525 20:51590254-51590276 TTCCTCTCAAGCTGCACCTCTGG + Intergenic
1175972455 20:62693571-62693593 TTCCCCAGAAGCAGCCCCTCGGG + Intergenic
1178432014 21:32525533-32525555 CTGCTCAGAAGTGGCTCCTCGGG + Intergenic
1178446307 21:32646878-32646900 TTGCACTGGAGAAGCTGCTCTGG - Intronic
1179537119 21:42059962-42059984 TTGCTCTGAAGCTGCCACTCAGG + Intergenic
1180031373 21:45210803-45210825 TTTTCCTGAAGCAGCTCCTGGGG - Intronic
1181920198 22:26314722-26314744 TTGCAGGGAAGCAGCTACTCTGG + Intronic
1182822040 22:33224859-33224881 TTGTTCTGATTCAGTTCCTCTGG - Intronic
1183068285 22:35378832-35378854 TGACTCTGAGGCAGCTCCTAAGG - Intergenic
950663002 3:14478208-14478230 TTGGTGTGAAGCACCTCCTTGGG + Intronic
953613516 3:44468685-44468707 TTGTGCTGAGTCAGCTCCTCGGG - Intronic
953710270 3:45264120-45264142 CTGCTCTGACCCTGCTCCTCTGG + Intergenic
953795006 3:45978242-45978264 TTGCTCTGATGCAGCGGCTGAGG + Intronic
954035688 3:47849798-47849820 CCGCTCTGCAGCTGCTCCTCCGG + Intronic
960698875 3:120421513-120421535 TTGCTCCCAGGCAGCTCTTCTGG + Intronic
966089186 3:176110034-176110056 TTTCTTTTAAGCAGCTCCTATGG + Intergenic
966943282 3:184760197-184760219 TTCCTCTGAAATCGCTCCTCTGG - Intergenic
968039692 3:195578817-195578839 TAGCTCTGTAGCAGCTACTATGG + Intronic
968435689 4:587696-587718 TTGCCCTGGAGCTGCTCCTCTGG + Intergenic
968492760 4:899236-899258 TATCTCAGAAGGAGCTCCTCTGG - Intronic
968871360 4:3244339-3244361 TGGCACTGAAGCAGGTCATCAGG + Intergenic
969338069 4:6523193-6523215 TTCCTCTGGAGCAGCTGCTTGGG - Intronic
970520183 4:16875689-16875711 TCGCTCTGCAGCAGCTCTTCTGG - Intronic
975418257 4:74131746-74131768 TTGCTGTGCAGAAGCTCCTTAGG - Intronic
975802991 4:78081743-78081765 ATGCCCTGAGGCAGCTGCTCAGG - Intronic
978362905 4:107949762-107949784 TTGCTCTTAAGTAGCTCCCTGGG - Intronic
979221684 4:118233937-118233959 CTTCTCATAAGCAGCTCCTCAGG - Intronic
979609326 4:122672799-122672821 TGGGTCTGAAGAAGCTCCTTGGG - Intergenic
979944288 4:126807233-126807255 TTGTTCTGTAGCATATCCTCAGG - Intergenic
981663644 4:147196433-147196455 TGGCTCTGATGCAGCTTCCCAGG - Intergenic
982383034 4:154770347-154770369 TTGGCCTGAAGTGGCTCCTCGGG + Intergenic
983629196 4:169832603-169832625 TTGCTGTGCTCCAGCTCCTCTGG + Intergenic
984904380 4:184613191-184613213 TCTCTCTGAAGCATGTCCTCTGG - Intergenic
985606231 5:859549-859571 TTGCTCAGAACCAGCTGCGCAGG - Intronic
986082497 5:4409374-4409396 TCACTCTGAAGCAGCTTCACCGG - Intergenic
986645458 5:9912293-9912315 TGGGTAGGAAGCAGCTCCTCTGG + Intergenic
991156067 5:63437325-63437347 TTGATCTGAAGCAGCTGTTGAGG + Intergenic
993454088 5:88107388-88107410 TTGCTGTGCAGAAGCTCTTCAGG - Intergenic
995174867 5:109164396-109164418 TTGCTTAGAAGGAGGTCCTCTGG + Intronic
997191934 5:131945610-131945632 TTGCTGTGAGGCTGCTCCGCGGG - Intronic
998790435 5:145760721-145760743 CTTCTCTGAACCAGCTCCTTTGG - Intronic
1000280773 5:159780091-159780113 TTGCTAAGAGGCTGCTCCTCTGG + Intergenic
1000728895 5:164806001-164806023 TTGCCCCTAAGCTGCTCCTCTGG - Intergenic
1002124062 5:177028640-177028662 TTGCTCTGGAGCAGTTCCAGAGG - Intronic
1004455931 6:15791422-15791444 TGGGTCTGAAGAAACTCCTCTGG - Intergenic
1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG + Intronic
1008956576 6:57222223-57222245 TGGCTCAGCAGCAGCTCCGCCGG + Exonic
1011029801 6:82909486-82909508 GAGCTCTGCAGCATCTCCTCTGG - Intronic
1014671562 6:124311206-124311228 TTGCTCTGAAGACCCTGCTCTGG - Intronic
1015316808 6:131826219-131826241 TTGCACTGAAACAGCCCATCTGG + Intronic
1016720043 6:147285990-147286012 TTGCTCTGAAGAAGGTCAGCTGG - Intronic
1016723593 6:147332530-147332552 TTGCTCTGAAGCAGTACACCTGG + Intronic
1017867467 6:158456275-158456297 TGGCTCTGAAGCAGCTTCTAAGG + Intronic
1020457209 7:8387588-8387610 CTTCTCTGCAGCAGCTCCTCAGG + Intergenic
1020568424 7:9825845-9825867 TTGCTGTGCAGAAGCTCCTTAGG + Intergenic
1023835700 7:44066022-44066044 GTGGTCTGCACCAGCTCCTCTGG - Intronic
1023954563 7:44873939-44873961 TTGCTCTAATGCAGCTCTTCAGG + Intergenic
1024349953 7:48353356-48353378 TGGCTCTGATGCAGGGCCTCAGG + Intronic
1028650649 7:93147013-93147035 TTGCTGGGAAGCTGCTCTTCTGG + Exonic
1029703769 7:102264727-102264749 TGGCTGAGAAGCAGCTCATCTGG - Intronic
1030005858 7:105119057-105119079 TTCCTCTGCAGAAGCTGCTCAGG - Intronic
1032914535 7:136474728-136474750 TTGCTCTGTAGAAGCTCTTTAGG + Intergenic
1033882978 7:145910150-145910172 TTGCTCTGAATCATCTCTTCGGG - Intergenic
1034561295 7:151880940-151880962 CTGGTCAGAGGCAGCTCCTCTGG - Intergenic
1035241995 7:157538223-157538245 TTGCTCTGAAGGAACACCTGAGG - Intergenic
1039065942 8:33607516-33607538 TTGTTCTGAGGCAGCTCCTGAGG + Intergenic
1041470722 8:58205594-58205616 TTGCTGTGCAGAAGCTCCTTAGG + Intergenic
1042569948 8:70153131-70153153 TTGCTCTAAAGCAGTACTTCTGG + Intronic
1046624291 8:116560522-116560544 ATGCTCTGCCTCAGCTCCTCTGG + Intergenic
1048064629 8:130955197-130955219 TGGCTCTGAAGCAACTACTGTGG + Intronic
1050192061 9:3037039-3037061 GTTCTCTGAAGCAGCTGCTTGGG + Intergenic
1050680329 9:8103709-8103731 TTGCTGTGCAGAAGCTCCTTAGG + Intergenic
1051522554 9:18005658-18005680 TTGCTATGAAGCATCACATCTGG + Intergenic
1051695347 9:19762286-19762308 TTGCTCTGCAGAAGCTCTTTAGG + Intronic
1053414656 9:37939506-37939528 TGGCTCAGAACCAGCCCCTCTGG + Intronic
1055917482 9:81420597-81420619 TTTTTCTGAAGCAGCTGCTAAGG - Intergenic
1058542516 9:106026705-106026727 TTGCTCTAAAACAGCTTTTCTGG + Intergenic
1058906664 9:109487483-109487505 TTGGTCTGAATCAGAGCCTCTGG - Intronic
1059284052 9:113157645-113157667 ATGCTCTCCAGCACCTCCTCTGG - Intronic
1060665948 9:125432224-125432246 GGGCTCTGCAGCAGATCCTCGGG + Intergenic
1062250556 9:135591743-135591765 TTGGTCTGGAGCAGGTCCCCAGG - Intergenic
1062492729 9:136815028-136815050 TGGCTCTGAAGCAGCACCTATGG - Intronic
1187669601 X:21656266-21656288 TTGCTCCAAACCTGCTCCTCAGG + Exonic
1190624803 X:52326676-52326698 CTTCTCTTGAGCAGCTCCTCTGG - Intergenic
1193243038 X:79195186-79195208 TGACTCTGAGGCAGCACCTCTGG + Intergenic
1197678731 X:129359480-129359502 TTGCTCTGAGTCAGTTCCTGTGG - Intergenic
1199622636 X:149713740-149713762 TTGGTCTGAGGCAGGTCCTCAGG + Intronic
1200210619 X:154345288-154345310 GTGCTCTGGGGCAGCTCCTTTGG - Intergenic
1200220233 X:154386804-154386826 GTGCTCTGGGGCAGCTCCTTTGG + Intergenic
1201193697 Y:11471234-11471256 TTGGGCTGAAGCAGGTCCTGGGG - Intergenic