ID: 1007180142

View in Genome Browser
Species Human (GRCh38)
Location 6:39923691-39923713
Sequence CAGCCAGCACAGGATGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007180131_1007180142 24 Left 1007180131 6:39923644-39923666 CCCTGAGGAGCTGCCTGGAACAT 0: 1
1: 0
2: 0
3: 27
4: 170
Right 1007180142 6:39923691-39923713 CAGCCAGCACAGGATGACAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1007180132_1007180142 23 Left 1007180132 6:39923645-39923667 CCTGAGGAGCTGCCTGGAACATG 0: 1
1: 0
2: 3
3: 20
4: 249
Right 1007180142 6:39923691-39923713 CAGCCAGCACAGGATGACAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1007180136_1007180142 11 Left 1007180136 6:39923657-39923679 CCTGGAACATGGGGTCAGCTTGC 0: 1
1: 0
2: 3
3: 10
4: 127
Right 1007180142 6:39923691-39923713 CAGCCAGCACAGGATGACAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007180142 Original CRISPR CAGCCAGCACAGGATGACAG AGG Intronic
900310292 1:2030140-2030162 CAGCCCGCTCAGGAGGCCAGGGG + Exonic
900385548 1:2408982-2409004 CAGCCAGCACGGGGTGACAGTGG - Intronic
900636371 1:3667954-3667976 CAACTAGCACAGAGTGACAGTGG - Intronic
902665029 1:17931429-17931451 CAGCCTGCCCAGGGTGACAGAGG + Intergenic
902890457 1:19439536-19439558 CAGCCAGCACCGCGTGACACAGG - Intronic
903218784 1:21857404-21857426 TAGCCAGCACCGGCTCACAGGGG - Intronic
907273714 1:53305479-53305501 CAGGTGGCCCAGGATGACAGAGG - Intronic
910843527 1:91584247-91584269 CAGTCAGGAGAGAATGACAGTGG - Intergenic
911658753 1:100475998-100476020 CAGCCAGCAAAGACTGAGAGGGG - Intronic
912448868 1:109757731-109757753 CAGACAGCAGAGGATTACTGGGG + Intronic
912473959 1:109924129-109924151 CAGCAAGACCAGGATGACACTGG - Exonic
913088404 1:115459519-115459541 GTGACAGCACAGGATGACAGAGG + Intergenic
913219862 1:116650694-116650716 CTGCCAGCACAGGATGGGGGTGG - Intronic
916208739 1:162341008-162341030 CAGGCATCACAAGATGACAATGG - Intronic
916662230 1:166933378-166933400 AAGCCAGCTGAGGAGGACAGAGG + Intronic
916746603 1:167689618-167689640 AAACCAGACCAGGATGACAGAGG - Intronic
917456048 1:175186940-175186962 TTGCCAGCACAGCATAACAGTGG - Intronic
918098014 1:181350315-181350337 CACCCAGCTCTGGATGACGGAGG - Intergenic
919021197 1:192108201-192108223 CATCCAGCAGAGGAGGACAGTGG + Intergenic
920219017 1:204382390-204382412 CAGCCCACACAGGCTGAGAGTGG - Intergenic
920697450 1:208192092-208192114 CAGGCAGCACGGGCTGAGAGAGG - Intronic
923063875 1:230500629-230500651 CAGCCAGAGCAGGATGACCTCGG + Intergenic
923773970 1:236961741-236961763 CAGGCATCACATGGTGACAGAGG - Intergenic
924261523 1:242236287-242236309 CAGCCTGAACAGACTGACAGTGG + Intronic
1063395880 10:5686660-5686682 TAGCCAGCACTGGATGATAATGG + Intronic
1063426758 10:5956417-5956439 CAGCCCACACAGCAGGACAGTGG + Exonic
1063559718 10:7114653-7114675 CAGCCAGCACAGGGTGCCACAGG - Intergenic
1064452245 10:15453018-15453040 CGGCAAGCTGAGGATGACAGAGG + Intergenic
1064972596 10:21081302-21081324 CAGCTGGCACAGGATGACAAAGG + Intronic
1065721254 10:28630423-28630445 CAGCTTCCACAGGATGAGAGAGG - Intergenic
1066167677 10:32805720-32805742 CAACCACCTCTGGATGACAGTGG - Intronic
1066508642 10:36070692-36070714 CAGCCAGCAGTTGTTGACAGAGG - Intergenic
1067052149 10:43027837-43027859 CTGCCAGCACAGCAGGAAAGTGG + Intergenic
1068772579 10:60838439-60838461 CAGTCATCACAGGATAACAGGGG - Intergenic
1068793209 10:61049515-61049537 CAGGCATCACAAGAAGACAGGGG + Intergenic
1069364066 10:67677710-67677732 AATGCAGCACAGGATGAGAGGGG + Intronic
1070806289 10:79272958-79272980 CAGGCTGGAGAGGATGACAGGGG + Intronic
1070855137 10:79602763-79602785 CAGTCAGCTGAGGATGACAGGGG - Intergenic
1072910516 10:99496893-99496915 CAGCCACCAGAGGCTGAAAGAGG + Intergenic
1073070879 10:100792532-100792554 GAGACAGAAGAGGATGACAGAGG + Intronic
1073895124 10:108146597-108146619 CAGTCATCCCAGGATGACAGTGG - Intergenic
1074577542 10:114684514-114684536 CAGCCAGCGCAGGAAGAATGAGG + Intronic
1075886037 10:125900093-125900115 CAGCAAGCAGAGGAAGGCAGGGG + Intronic
1075914179 10:126153026-126153048 CAGCAAGGACAGGAAGTCAGAGG - Intronic
1076582842 10:131524757-131524779 CAGCCACTACAGGATGAAACAGG - Intergenic
1077976716 11:7254298-7254320 TAGCCAGCTCATGAGGACAGGGG + Intronic
1079345842 11:19651570-19651592 CAGCAAGCCCATGCTGACAGGGG - Intronic
1080540211 11:33257722-33257744 CCGCCAGGACAAGATGGCAGCGG + Exonic
1083825907 11:65204035-65204057 CAGCCAGCAAGGGAAGGCAGGGG - Intronic
1084569059 11:69948820-69948842 CGGGCAGCACAGGCTGCCAGAGG - Intergenic
1084570555 11:69957101-69957123 CATCCAGCCCAGCATGGCAGTGG + Intergenic
1084834875 11:71795202-71795224 CCGCCTGCACAGGATGCCCGGGG - Intronic
1085511667 11:77091320-77091342 CGGCCAGCAGAGGGTGGCAGAGG - Intronic
1086112089 11:83210324-83210346 CTGACAGCCCAGGATGACCGGGG + Exonic
1087882645 11:103436535-103436557 CAACAAGCAGAGGAAGACAGTGG - Intronic
1088504516 11:110515140-110515162 CAGCCAGCTCAGGAAGGGAGAGG + Intergenic
1090090171 11:123689573-123689595 CAGCCAGCACAGACTGAAAAAGG - Intergenic
1090101838 11:123805726-123805748 CAGGGAGCTCAGGATGACAAGGG + Exonic
1090665395 11:128911843-128911865 CAGCCAGCCCAAGAAGAGAGCGG + Exonic
1091919664 12:4294191-4294213 CAGCAAGCAGAGGAAGTCAGAGG + Intronic
1094365405 12:29674636-29674658 CAGCCAGCTCAGGAGGAGGGAGG + Intronic
1094394747 12:29993768-29993790 CAGCCACCAGAAGATGAAAGAGG + Intergenic
1094850239 12:34379110-34379132 CAGGTTGCACAGGATGACAAGGG + Intergenic
1097694485 12:62763261-62763283 CAGCCAGTCCAGGGTTACAGGGG - Intronic
1099163511 12:79274436-79274458 CAGTCTGCACAGGAAGAGAGGGG - Intronic
1100675352 12:96860352-96860374 CAGCCTGCCCAGGATGACTTTGG + Intronic
1103494763 12:121353099-121353121 CAGCCAGATCAGGTTGCCAGTGG + Intronic
1105892638 13:24692548-24692570 GACCCAGAACAGGATGACAGTGG + Exonic
1106756818 13:32829979-32830001 GACCCAGCAGAGGCTGACAGTGG - Intergenic
1107837516 13:44423645-44423667 CTGCCAGGACAGGAAGATAGAGG - Intergenic
1107840564 13:44452533-44452555 CAGCCAGGCCATGAGGACAGTGG - Intronic
1109308428 13:60664395-60664417 CAGCCAGCACTAGGTGAGAGAGG + Intergenic
1109413385 13:62004238-62004260 GAGCCTGAACAGGATGAAAGGGG - Intergenic
1110445812 13:75578932-75578954 CAGCCAGTACAGACTGTCAGTGG + Intronic
1111654737 13:91138509-91138531 CAGGCAGCATAGGATGTCACAGG - Intergenic
1112010029 13:95286054-95286076 CAGCCAGCAAAGGCTGACTGGGG + Intronic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1114527644 14:23376686-23376708 CAGCCAGGACTGGAGGACAAAGG - Intergenic
1118457657 14:65959215-65959237 CAGGCAGAACAGGATGGCTGAGG - Intronic
1119168173 14:72513135-72513157 GAGGGAGCACAGGAGGACAGAGG - Intronic
1120074674 14:80141895-80141917 CAGCCATCAGAGGCTGAAAGAGG + Intergenic
1121521069 14:94586650-94586672 CAGCCAGAACAGGAGGACGGTGG + Intronic
1122501569 14:102203609-102203631 CAGCCAACACAGCAGGCCAGGGG - Intronic
1202872038 14_GL000225v1_random:173868-173890 CAGCAAGCAGAGGAAGGCAGGGG - Intergenic
1125241178 15:37578320-37578342 CAGCCTTCACAGCATGAAAGTGG + Intergenic
1126176854 15:45743801-45743823 CAGCTACCACAGGATGACAAAGG + Intergenic
1126694798 15:51316907-51316929 TAGCCAGCAAAGGATGAAAAGGG - Intronic
1127609288 15:60621474-60621496 CAGCCTGCACAGGCTTGCAGGGG + Intronic
1130982013 15:88819148-88819170 CAGCCAGTACAGGCTGGCAGAGG + Intronic
1132904126 16:2273530-2273552 CTGCCATCACAGGTTTACAGCGG - Intergenic
1135522953 16:23191234-23191256 CAGCCACCTCTGGAGGACAGGGG + Intronic
1139315439 16:66063844-66063866 CAAACAGCACAGCCTGACAGAGG + Intergenic
1140842756 16:78856186-78856208 GGGCCAGAACAGAATGACAGAGG + Intronic
1141204591 16:81923686-81923708 AAGCCAGCCCAGGATGACAAAGG - Intronic
1141498039 16:84423646-84423668 CAGCCAGCAGATGGTGAAAGAGG + Intronic
1141516012 16:84545562-84545584 CTTCCAGCACAGCATGGCAGGGG - Intronic
1143631570 17:8143193-8143215 CAGGCAGCACAGGGTGGCAGAGG + Intronic
1144087513 17:11823968-11823990 TAACAAGGACAGGATGACAGGGG - Intronic
1145269249 17:21395996-21396018 CAGCCAGCCCAGGATGTCCTCGG + Intronic
1146503916 17:33388211-33388233 CAGCCAGCAGAAGCTGAAAGAGG + Intronic
1150828640 17:68498715-68498737 GAGCCAGCACAGGAAGCAAGCGG - Intergenic
1152118362 17:78402816-78402838 CATCCAACTCAGGAAGACAGGGG - Intronic
1152640870 17:81448700-81448722 CATCCAGCACAGGGTGACCACGG - Intronic
1153211554 18:2772179-2772201 CAGGCAGCCCATAATGACAGTGG - Intronic
1153502130 18:5760397-5760419 CCGCCATCCCAGGATCACAGTGG - Intergenic
1156546500 18:37969013-37969035 CAGACACCTCTGGATGACAGGGG - Intergenic
1157583656 18:48787705-48787727 CAGACTGCACAGGCAGACAGAGG - Intronic
1157855272 18:51099647-51099669 CATCCTGCACTGGATGAGAGGGG + Intergenic
1159180092 18:64892080-64892102 CAGCCACCAGAGGTTGAGAGAGG + Intergenic
1159619666 18:70622727-70622749 CAGTCAGCACAGGAAGACCAGGG - Intergenic
1160368734 18:78352686-78352708 CATCCAGGACAGAATAACAGGGG + Intergenic
1160620371 18:80166654-80166676 GAGCCAGGACAGGATGAAAGGGG - Intronic
1161261028 19:3337743-3337765 CAAGCAGCACAGGGTGGCAGAGG - Intergenic
1161415861 19:4145932-4145954 CATTCTGCACAGGAGGACAGAGG - Intergenic
1162506756 19:11090329-11090351 CACCCAACTCAGGATGGCAGTGG - Intronic
1162863696 19:13527492-13527514 CAGAGACCACATGATGACAGAGG + Intronic
1163129922 19:15265927-15265949 CAGGAAGCACATGCTGACAGGGG + Intronic
1163712974 19:18857800-18857822 CAGCCAGGACAGGCTGTTAGGGG + Intronic
1163726035 19:18923625-18923647 GAGCCAGCAGAGGAAAACAGAGG - Intronic
1163834157 19:19563151-19563173 CAGCCAGCAGAGGAGGCCGGAGG - Intronic
1165020459 19:32920075-32920097 CAGGCAGGACAGGAGTACAGTGG + Intronic
1165229750 19:34379469-34379491 CAGCCAGCCCAGGGAGACAAAGG - Intronic
1165350645 19:35273295-35273317 CAGACAGCAAAGGAGGCCAGTGG - Intronic
1166033799 19:40152781-40152803 AAGACAGCACAGGCTGAGAGTGG + Intergenic
1166135418 19:40774146-40774168 CAGGCAGCACAGTAAGACATTGG + Intronic
1166834612 19:45659600-45659622 CAGACAGGAGAGGAAGACAGAGG + Intergenic
1167287542 19:48606974-48606996 CAGCCAGCACAGGACCATGGCGG - Exonic
1168013472 19:53553735-53553757 CCGCCAGCACAGGCTGCCCGAGG - Intronic
925877799 2:8327617-8327639 CAGCCACCAGAGTATGAGAGTGG + Intergenic
926108205 2:10165650-10165672 CACCCAGGAGAGGATGAGAGCGG - Intronic
927157661 2:20230782-20230804 CAGCCACCAGAGGCTGAAAGGGG - Intergenic
933725462 2:85424338-85424360 AAGGAAGCACAGGAAGACAGAGG - Intronic
934941040 2:98502160-98502182 CAGCCAGCCCAGGAGAACACAGG - Intronic
934970713 2:98761886-98761908 CAGCCAGCCCAGGACTCCAGAGG + Intergenic
935301699 2:101698260-101698282 CAGCCCGCACAGGAAGACAAAGG - Intronic
935664499 2:105498355-105498377 GACCCAGCACAGGAAGGCAGGGG + Intergenic
936973669 2:118198403-118198425 CAGCCATCACAGGAAGTCACAGG - Intergenic
938063525 2:128269364-128269386 CAGCCAGCCCAGGACCCCAGAGG + Intronic
938092335 2:128441773-128441795 CAGCCATCACAGGGTGGCACCGG + Intergenic
938616998 2:133009730-133009752 GAGCCAGAAGAGGATGCCAGGGG + Intronic
939050953 2:137307339-137307361 CAGCCCGCCCAGAATGAGAGGGG + Intronic
939106623 2:137956019-137956041 CAGCGAGCACAGGAGGAGAAAGG + Intergenic
939697438 2:145343950-145343972 CAGCAGGCAGAGTATGACAGGGG - Intergenic
940212386 2:151268484-151268506 TATCCAGCACAGGTTGGCAGGGG - Intergenic
942547715 2:177081892-177081914 CAGCCACCACAGTCTGACTGAGG + Intergenic
944906874 2:204270562-204270584 GAGTCAGCAAAGGAAGACAGAGG + Intergenic
946011638 2:216569306-216569328 CAGGCAGAACAAGGTGACAGGGG + Intronic
947136287 2:226979584-226979606 CATCCCGCACAGGAGGAGAGAGG + Intronic
948759149 2:240179748-240179770 GAGCCAGTGCAGGATGAGAGAGG + Intergenic
948779277 2:240308072-240308094 CAGTCATCACAGGATGACCTTGG + Intergenic
948781332 2:240323735-240323757 CAGGCTGCAAAGGCTGACAGAGG + Intergenic
1171448203 20:25219314-25219336 CAGACAGCACAGGAGGGCTGTGG + Intronic
1171523625 20:25793714-25793736 GAGACAGCACAGGATGGGAGGGG + Intronic
1171553202 20:26062169-26062191 GAGACAGCACAGGATGGGAGGGG - Intergenic
1173738052 20:45375572-45375594 CAGTCAGCACAGCAGGACCGAGG + Intronic
1173836955 20:46132217-46132239 CAGCCAGCCAAGGTTGAAAGTGG + Intergenic
1174205081 20:48832326-48832348 CAGCCTGCAGAAGCTGACAGGGG - Intergenic
1175312437 20:58020992-58021014 CAGCCAGCACAGGCAGACTGTGG + Intergenic
1175817630 20:61891699-61891721 CACCCAGAACAGGGTGACTGTGG - Intronic
1176069592 20:63219079-63219101 CACCCAGCACCGAATGTCAGGGG + Intergenic
1176178402 20:63739082-63739104 GCGCCAGCGCAGGATGAAAGCGG + Exonic
1177557709 21:22713700-22713722 GAGCCAGCATAGGCTGACACTGG - Intergenic
1178128125 21:29538307-29538329 GAGCCAGCACAGGAGGACAAAGG + Intronic
1178600129 21:33987589-33987611 CAGGCAGGACAGGATGGGAGTGG + Intergenic
1178828056 21:36032593-36032615 CAGCCCCCACAGTAGGACAGTGG - Intergenic
1180011151 21:45052354-45052376 CAGCCAGCACAGGAACAGACCGG + Intergenic
1180224079 21:46379218-46379240 CACGCAGCCCCGGATGACAGGGG - Intronic
1180286056 22:10745624-10745646 CAGCAAGCAGAGGAAGGCAGGGG + Intergenic
1180821156 22:18828725-18828747 CTGCCAGCACAGGATGGGGGTGG - Intergenic
1181191822 22:21147320-21147342 CTGCCAGCACAGGATGGGGGTGG + Intergenic
1181207374 22:21263190-21263212 CTGCCAGCACAGGATGGGGGTGG - Intergenic
1181415490 22:22755902-22755924 CCTCCAGCCCAGGAAGACAGTGG + Intronic
1181531610 22:23520651-23520673 CAGCCAGCACAGGGCCGCAGTGG + Intergenic
1181990338 22:26832263-26832285 CAGCCAGCCCAGGAAACCAGAGG - Intergenic
1182687126 22:32129747-32129769 CATGCAGCAGAGGCTGACAGTGG + Intergenic
1183152117 22:36046081-36046103 GAGCCAGCACTGGGTGTCAGAGG - Intergenic
1183894737 22:40959286-40959308 AACCCAGAACAGGTTGACAGTGG - Intronic
1184255826 22:43286327-43286349 GAGACAGCACAGGCTCACAGCGG - Intronic
1184316569 22:43697907-43697929 GAGGCAGCAAAGGGTGACAGAGG + Intronic
1185222797 22:49637355-49637377 CTGCCAGCACAGGAGCACACGGG + Intronic
1203219544 22_KI270731v1_random:32226-32248 CTGCCAGCACAGGATGGGGGTGG + Intergenic
1203271281 22_KI270734v1_random:54601-54623 CTGCCAGCACAGGATGGGGGTGG - Intergenic
952007905 3:28863512-28863534 CAGAAAGAACAGAATGACAGAGG - Intergenic
954661946 3:52231054-52231076 CAGGCAGCACAGGCTGCCACTGG + Intronic
955994712 3:64668092-64668114 CAGCCAGGACAGGGTGTCTGTGG - Intronic
956046390 3:65200467-65200489 CAGCCATCACTGGATGTCACAGG + Intergenic
956429146 3:69166783-69166805 AAGGCAGAAAAGGATGACAGTGG + Intergenic
961816397 3:129552885-129552907 CAGCCAGGACATGCTCACAGAGG + Intergenic
961887134 3:130103707-130103729 CCGCCTGCACAGGATGCCCGGGG + Intronic
962252402 3:133843843-133843865 CATCCAGATGAGGATGACAGAGG + Intronic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
966906827 3:184532288-184532310 CAGACAGCACAGGCTGAAAGAGG - Intronic
968996272 4:3947708-3947730 CCGCCTGCACAGGATGCCCGGGG + Intergenic
969156971 4:5219512-5219534 CAGACAGCAGAGGGTCACAGAGG + Intronic
969702183 4:8773731-8773753 CAGCCAGCAGAGGGGGACACGGG + Intergenic
969757710 4:9160982-9161004 CCGCCTGCACAGGATGCCCGGGG - Intergenic
969817688 4:9698495-9698517 CTGCCTGCACAGGATGCCCGGGG - Intergenic
971252498 4:24985225-24985247 CACCCAAGACAGGAGGACAGAGG - Intergenic
971524724 4:27602500-27602522 CAGGTAGCACAGGCTGAGAGAGG + Intergenic
971653203 4:29306641-29306663 CAGCCACCTAATGATGACAGTGG + Intergenic
971701631 4:29984738-29984760 CATCCACCACAAGTTGACAGAGG + Intergenic
972930385 4:44064615-44064637 CAGGCATCACATGGTGACAGAGG - Intergenic
973636254 4:52863684-52863706 CAGCCAGCAGAGAAGGAGAGGGG - Intronic
975008250 4:69317866-69317888 CAGCCAGTACAGCATGGCACAGG + Intronic
975683306 4:76897143-76897165 CTGCCTGCCCAGGATGACCGCGG - Exonic
975799842 4:78048971-78048993 CAGCCAGAAAACGATGACGGTGG - Intergenic
975820743 4:78267959-78267981 CAGACAGCAGAGGTTAACAGAGG - Intronic
984570054 4:181381354-181381376 CAGCCACCAGAGGCTGAAAGTGG - Intergenic
985348573 4:189034082-189034104 CAGACAGCACAGACTGCCAGAGG - Intergenic
986037865 5:3958485-3958507 GAGCCTGTACAGGAAGACAGTGG - Intergenic
986525277 5:8667074-8667096 CAGTGAGCACAGAATGCCAGTGG + Intergenic
986719162 5:10547802-10547824 GAGGCAGCACAGGATGAAACTGG - Intergenic
986819474 5:11449523-11449545 CAGCCATCTGAGGATCACAGGGG + Intronic
987860786 5:23485440-23485462 CAGCCACCAGAAGATGAAAGAGG + Intergenic
988255217 5:28810383-28810405 CAGCGGGCACAGGACGGCAGGGG - Intergenic
990539713 5:56760214-56760236 CAGCAAGAACAGGAGGACAAGGG + Intergenic
991668422 5:69023051-69023073 CAGCCAGCACTGGCTCACAGTGG - Intergenic
994515085 5:100760844-100760866 CAGGCACCACAGGGAGACAGAGG - Intergenic
995240865 5:109884525-109884547 CAGCCTGTACAGGAGGACGGAGG + Exonic
995838281 5:116420114-116420136 CAGCCAGCAAAGGAAAGCAGAGG + Intergenic
996366187 5:122703716-122703738 AAGCCATCACAGGATGACACAGG + Intergenic
997842669 5:137256469-137256491 CAGGCATCACATGGTGACAGAGG + Intronic
999990565 5:157046294-157046316 GAGCCAGCTCAGCATCACAGAGG + Intronic
1001269508 5:170300959-170300981 GAGCCTGCACAGGGTCACAGTGG - Intergenic
1001668882 5:173457330-173457352 AATCCAGCACAGGAAGAGAGAGG - Intergenic
1002310842 5:178312785-178312807 CAGCCAGCCCCTGAGGACAGGGG + Intronic
1004558115 6:16719835-16719857 GAACCACCAGAGGATGACAGCGG + Intronic
1005454425 6:26005595-26005617 TAACCAGCACAGGGTGACACTGG - Intergenic
1006406036 6:33845590-33845612 AAGCCTGCAGAGGAAGACAGAGG - Intergenic
1006805892 6:36788875-36788897 GAACCAGCAAAGGATGACAGTGG - Intronic
1007019638 6:38506433-38506455 CAGCCAGCACGGGATCACGAGGG - Intronic
1007180142 6:39923691-39923713 CAGCCAGCACAGGATGACAGAGG + Intronic
1007582838 6:42969447-42969469 GAGCCAGCCCTGGAGGACAGAGG + Intronic
1009749658 6:67867727-67867749 CAGCCAGCAAAGGGAGATAGGGG + Intergenic
1014174025 6:118311755-118311777 CATCCAGCCTAGGGTGACAGAGG + Intronic
1014317347 6:119884317-119884339 CAGCCAGCACAGGATAAAGGAGG - Intergenic
1014457032 6:121647845-121647867 CAGTCAACAAAGGATGACAATGG + Intergenic
1017962900 6:159237317-159237339 AAGCCAGCTCAGGATCACTGAGG + Intronic
1018030467 6:159837302-159837324 AAGCCAGCAGAGGAAGCCAGAGG + Intergenic
1018678619 6:166244364-166244386 CATCCAGCACCTCATGACAGCGG + Intergenic
1019003627 6:168777843-168777865 CACCCAGCACATGAATACAGTGG - Intergenic
1019102874 6:169646328-169646350 CACCCAGGACAGGATGCCAATGG + Intronic
1019942757 7:4304182-4304204 CACCCAGCAGAGGGTGGCAGGGG - Intergenic
1021763538 7:23924662-23924684 CAGCCATCACAAGCTGAAAGAGG + Intergenic
1022540399 7:31129378-31129400 CAGACAGCAGAGGGTGGCAGGGG + Intergenic
1024634247 7:51274309-51274331 CAGTCAGCACTGGAGGACAAAGG - Intronic
1029421061 7:100472188-100472210 CTGGCAGGACAGGATGCCAGTGG - Intronic
1029445202 7:100608064-100608086 CAGCCCGCACAGGTTGAGAGGGG - Exonic
1032087939 7:128893473-128893495 CAGCCTGGATGGGATGACAGGGG + Exonic
1032483213 7:132263080-132263102 CAGCCTGCACAGGACCACTGAGG + Intronic
1034987614 7:155526750-155526772 CAGCCAGCAGTGGGTGACAGAGG - Intronic
1035246740 7:157567379-157567401 CAGCCAGCAAAGGATGCTGGCGG + Intronic
1035384116 7:158459036-158459058 CGGCCATCACAGGGTGACACCGG + Intronic
1036506361 8:9360060-9360082 CATCCAGCACAGGGTGAAAGAGG + Intergenic
1036848605 8:12186318-12186340 CCGCCTGCACAGGATGCCCGGGG + Intronic
1036869967 8:12428599-12428621 CCGCCTGCACAGGATGCCCGGGG + Intronic
1037024944 8:14023755-14023777 GAGCCAGCAGAGAATGACATGGG + Intergenic
1037324234 8:17672710-17672732 AAGCCAGCACTGGGTGACTGGGG + Intronic
1037553318 8:19996396-19996418 CAGAGAGCATAGGATGGCAGGGG + Intergenic
1037890307 8:22620604-22620626 CAGGCAGCCCAGCATGCCAGGGG - Exonic
1038395877 8:27245007-27245029 CAGCCAGCACAGAAAGGCAAGGG - Intronic
1041411203 8:57557906-57557928 GAGCTACCACAGGATGAAAGTGG + Intergenic
1041555532 8:59150351-59150373 CAGGTATCACAGGATGAAAGAGG - Intergenic
1042936454 8:74063948-74063970 CAACCAACAGAGTATGACAGGGG - Intergenic
1043364903 8:79521373-79521395 CAGCCAGCAGAGTATGGCAAGGG + Intergenic
1044775258 8:95680064-95680086 CAGCCAGGACAGGTTTAAAGAGG - Intergenic
1047029168 8:120857865-120857887 CAGTCAGCCCAGGATGAGGGTGG - Intergenic
1049044149 8:140136318-140136340 GAGCCCACACAGGAGGACAGGGG + Intronic
1049219183 8:141421128-141421150 CAGCCAGCAGGGCATGACGGAGG - Intronic
1049618407 8:143586633-143586655 CAGCCAGGCCAGGAAGGCAGAGG - Intronic
1050038653 9:1464136-1464158 CTTCCAGTAAAGGATGACAGAGG + Intergenic
1054823171 9:69544308-69544330 CAGCCATCAAAGAGTGACAGGGG - Intronic
1057512562 9:95692950-95692972 CAGACAGCATTGGGTGACAGTGG - Intergenic
1057705272 9:97391246-97391268 CACCCAGCACATGATGACCCAGG + Intergenic
1057897955 9:98924693-98924715 CAGCAAGCACAGAATTGCAGAGG - Intergenic
1058748812 9:108018476-108018498 CAGCCAGCAGAGGCTGGAAGAGG + Intergenic
1060298585 9:122360452-122360474 CAGCAACCAAAGGATGGCAGGGG + Intergenic
1060997925 9:127885585-127885607 CAGCCATCCCAGGACGACAGAGG + Exonic
1061248896 9:129415133-129415155 CAGCCAGCACAGGGCCGCAGTGG - Intergenic
1061435132 9:130556418-130556440 CAACCAATACAGGAAGACAGAGG + Intergenic
1062133479 9:134912758-134912780 CAGACTCCACAGGATGAAAGAGG + Intronic
1062398581 9:136362653-136362675 CAGCCACCCCAAGATGGCAGAGG + Intronic
1062507351 9:136884860-136884882 CAGCCAGCTCGGGATGAGAAAGG - Intronic
1203732409 Un_GL000216v2:102693-102715 CAGCAAGCAGAGGAAGACAGGGG + Intergenic
1186156031 X:6727795-6727817 CAGGTGGCACAGGATGACACAGG + Intergenic
1188146145 X:26616375-26616397 CAGGCATCACATGATGAGAGAGG + Intergenic
1191103572 X:56758704-56758726 CACCCACCACAGGAACACAGAGG - Intergenic
1192404804 X:70874100-70874122 CAGGCATCACATGATGAGAGAGG - Intronic
1194558639 X:95393835-95393857 CAGTCACCACAGGCTGACAGAGG + Intergenic
1196721976 X:118862983-118863005 CAGAGAGCAGAGGATGCCAGAGG - Intergenic
1197748952 X:129952144-129952166 CAGACAGAAAAGGCTGACAGTGG - Intergenic
1199760472 X:150900329-150900351 CAGCCTGCACACAGTGACAGAGG + Intergenic
1200063990 X:153496148-153496170 CAGCCAGGACAGCAGGAGAGAGG - Intronic
1200068341 X:153515635-153515657 CAGGCACCACAGGAGGGCAGAGG - Intergenic
1201549404 Y:15204061-15204083 CAGGTGGCACAGGATGACACAGG + Intergenic
1202628539 Y:56884893-56884915 CAGCAAGCAGAGGAAGGCAGGGG - Intergenic