ID: 1007182203

View in Genome Browser
Species Human (GRCh38)
Location 6:39937487-39937509
Sequence CCTGACCTCTGGTTTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007182196_1007182203 7 Left 1007182196 6:39937457-39937479 CCAACTGCATTGATGGCATCATC No data
Right 1007182203 6:39937487-39937509 CCTGACCTCTGGTTTCCAGGTGG No data
1007182194_1007182203 25 Left 1007182194 6:39937439-39937461 CCAGGAGATTGACTTCTACCAAC No data
Right 1007182203 6:39937487-39937509 CCTGACCTCTGGTTTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007182203 Original CRISPR CCTGACCTCTGGTTTCCAGG TGG Intergenic