ID: 1007188009

View in Genome Browser
Species Human (GRCh38)
Location 6:39988926-39988948
Sequence TTGGATGATACTGATTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007188008_1007188009 -8 Left 1007188008 6:39988911-39988933 CCTTGGTATATTTGATTGGATGA No data
Right 1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG No data
1007188002_1007188009 17 Left 1007188002 6:39988886-39988908 CCAATACTAAAACCCATTTATGG No data
Right 1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG No data
1007188006_1007188009 4 Left 1007188006 6:39988899-39988921 CCATTTATGGTTCCTTGGTATAT No data
Right 1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG No data
1007188005_1007188009 5 Left 1007188005 6:39988898-39988920 CCCATTTATGGTTCCTTGGTATA No data
Right 1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007188009 Original CRISPR TTGGATGATACTGATTTTGT TGG Intergenic
No off target data available for this crispr