ID: 1007192195

View in Genome Browser
Species Human (GRCh38)
Location 6:40028939-40028961
Sequence AGTTAGAAAAAGCACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007192186_1007192195 25 Left 1007192186 6:40028891-40028913 CCACTGGCACAAGGTGGGACAGA No data
Right 1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007192195 Original CRISPR AGTTAGAAAAAGCACTTTGG GGG Intergenic
No off target data available for this crispr