ID: 1007193437

View in Genome Browser
Species Human (GRCh38)
Location 6:40039217-40039239
Sequence ATAGCCCCACAGACAAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007193437_1007193440 -10 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193440 6:40039230-40039252 GTGGGGCTATGACAGGAAGCAGG No data
1007193437_1007193445 19 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193445 6:40039259-40039281 GTGAGAGCAGCCTGATCAGAAGG No data
1007193437_1007193446 26 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG No data
1007193437_1007193442 -8 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193442 6:40039232-40039254 GGGGCTATGACAGGAAGCAGGGG No data
1007193437_1007193441 -9 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193441 6:40039231-40039253 TGGGGCTATGACAGGAAGCAGGG No data
1007193437_1007193444 -3 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193444 6:40039237-40039259 TATGACAGGAAGCAGGGGGATGG No data
1007193437_1007193447 27 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193447 6:40039267-40039289 AGCCTGATCAGAAGGACTCAGGG No data
1007193437_1007193443 -7 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193443 6:40039233-40039255 GGGCTATGACAGGAAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007193437 Original CRISPR ATAGCCCCACAGACAAGGAA TGG (reversed) Intergenic
No off target data available for this crispr