ID: 1007193438

View in Genome Browser
Species Human (GRCh38)
Location 6:40039222-40039244
Sequence CTGTCATAGCCCCACAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007193438_1007193446 21 Left 1007193438 6:40039222-40039244 CCTTGTCTGTGGGGCTATGACAG No data
Right 1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG No data
1007193438_1007193447 22 Left 1007193438 6:40039222-40039244 CCTTGTCTGTGGGGCTATGACAG No data
Right 1007193447 6:40039267-40039289 AGCCTGATCAGAAGGACTCAGGG No data
1007193438_1007193445 14 Left 1007193438 6:40039222-40039244 CCTTGTCTGTGGGGCTATGACAG No data
Right 1007193445 6:40039259-40039281 GTGAGAGCAGCCTGATCAGAAGG No data
1007193438_1007193444 -8 Left 1007193438 6:40039222-40039244 CCTTGTCTGTGGGGCTATGACAG No data
Right 1007193444 6:40039237-40039259 TATGACAGGAAGCAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007193438 Original CRISPR CTGTCATAGCCCCACAGACA AGG (reversed) Intergenic
No off target data available for this crispr