ID: 1007193446

View in Genome Browser
Species Human (GRCh38)
Location 6:40039266-40039288
Sequence CAGCCTGATCAGAAGGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007193437_1007193446 26 Left 1007193437 6:40039217-40039239 CCATTCCTTGTCTGTGGGGCTAT No data
Right 1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG No data
1007193438_1007193446 21 Left 1007193438 6:40039222-40039244 CCTTGTCTGTGGGGCTATGACAG No data
Right 1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007193446 Original CRISPR CAGCCTGATCAGAAGGACTC AGG Intergenic
No off target data available for this crispr