ID: 1007194782

View in Genome Browser
Species Human (GRCh38)
Location 6:40051063-40051085
Sequence CCCCCATATTGGCCCTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007194782_1007194798 6 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194798 6:40051092-40051114 GTGGGGGCTAGGGGGTTAAGAGG No data
1007194782_1007194795 -4 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194795 6:40051082-40051104 GGGGTGGGGGGTGGGGGCTAGGG No data
1007194782_1007194796 -3 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194796 6:40051083-40051105 GGGTGGGGGGTGGGGGCTAGGGG No data
1007194782_1007194799 7 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194799 6:40051093-40051115 TGGGGGCTAGGGGGTTAAGAGGG No data
1007194782_1007194797 -2 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194797 6:40051084-40051106 GGTGGGGGGTGGGGGCTAGGGGG No data
1007194782_1007194800 8 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194800 6:40051094-40051116 GGGGGCTAGGGGGTTAAGAGGGG No data
1007194782_1007194794 -5 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194794 6:40051081-40051103 GGGGGTGGGGGGTGGGGGCTAGG No data
1007194782_1007194793 -10 Left 1007194782 6:40051063-40051085 CCTCAAAAGGGCCAATATGGGGG No data
Right 1007194793 6:40051076-40051098 AATATGGGGGTGGGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007194782 Original CRISPR CCCCCATATTGGCCCTTTTG AGG (reversed) Intergenic
No off target data available for this crispr