ID: 1007198257

View in Genome Browser
Species Human (GRCh38)
Location 6:40082396-40082418
Sequence ATTCTTCTCTGGCAATTTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007198257_1007198271 26 Left 1007198257 6:40082396-40082418 CCGAAAAATTGCCAGAGAAGAAT No data
Right 1007198271 6:40082445-40082467 CCACCTGGGACCACTCTCAAGGG No data
1007198257_1007198269 25 Left 1007198257 6:40082396-40082418 CCGAAAAATTGCCAGAGAAGAAT No data
Right 1007198269 6:40082444-40082466 TCCACCTGGGACCACTCTCAAGG No data
1007198257_1007198261 11 Left 1007198257 6:40082396-40082418 CCGAAAAATTGCCAGAGAAGAAT No data
Right 1007198261 6:40082430-40082452 TCTCACCCCCCTCCTCCACCTGG No data
1007198257_1007198272 27 Left 1007198257 6:40082396-40082418 CCGAAAAATTGCCAGAGAAGAAT No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data
1007198257_1007198262 12 Left 1007198257 6:40082396-40082418 CCGAAAAATTGCCAGAGAAGAAT No data
Right 1007198262 6:40082431-40082453 CTCACCCCCCTCCTCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007198257 Original CRISPR ATTCTTCTCTGGCAATTTTT CGG (reversed) Intergenic
No off target data available for this crispr