ID: 1007198258

View in Genome Browser
Species Human (GRCh38)
Location 6:40082407-40082429
Sequence TGGGTAGAAAGATTCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007198258_1007198271 15 Left 1007198258 6:40082407-40082429 CCAGAGAAGAATCTTTCTACCCA No data
Right 1007198271 6:40082445-40082467 CCACCTGGGACCACTCTCAAGGG No data
1007198258_1007198274 24 Left 1007198258 6:40082407-40082429 CCAGAGAAGAATCTTTCTACCCA No data
Right 1007198274 6:40082454-40082476 ACCACTCTCAAGGGGCTCCAAGG No data
1007198258_1007198262 1 Left 1007198258 6:40082407-40082429 CCAGAGAAGAATCTTTCTACCCA No data
Right 1007198262 6:40082431-40082453 CTCACCCCCCTCCTCCACCTGGG No data
1007198258_1007198269 14 Left 1007198258 6:40082407-40082429 CCAGAGAAGAATCTTTCTACCCA No data
Right 1007198269 6:40082444-40082466 TCCACCTGGGACCACTCTCAAGG No data
1007198258_1007198261 0 Left 1007198258 6:40082407-40082429 CCAGAGAAGAATCTTTCTACCCA No data
Right 1007198261 6:40082430-40082452 TCTCACCCCCCTCCTCCACCTGG No data
1007198258_1007198272 16 Left 1007198258 6:40082407-40082429 CCAGAGAAGAATCTTTCTACCCA No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007198258 Original CRISPR TGGGTAGAAAGATTCTTCTC TGG (reversed) Intergenic
No off target data available for this crispr