ID: 1007198260

View in Genome Browser
Species Human (GRCh38)
Location 6:40082427-40082449
Sequence GGTGGAGGAGGGGGGTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007198260_1007198280 23 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198280 6:40082473-40082495 AAGGATTTACAGTATGGGTTGGG No data
1007198260_1007198282 28 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198282 6:40082478-40082500 TTTACAGTATGGGTTGGGCTGGG No data
1007198260_1007198269 -6 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198269 6:40082444-40082466 TCCACCTGGGACCACTCTCAAGG No data
1007198260_1007198277 18 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198277 6:40082468-40082490 GCTCCAAGGATTTACAGTATGGG No data
1007198260_1007198274 4 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198274 6:40082454-40082476 ACCACTCTCAAGGGGCTCCAAGG No data
1007198260_1007198281 27 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198281 6:40082477-40082499 ATTTACAGTATGGGTTGGGCTGG No data
1007198260_1007198279 22 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198279 6:40082472-40082494 CAAGGATTTACAGTATGGGTTGG No data
1007198260_1007198272 -4 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data
1007198260_1007198276 17 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198276 6:40082467-40082489 GGCTCCAAGGATTTACAGTATGG No data
1007198260_1007198271 -5 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198271 6:40082445-40082467 CCACCTGGGACCACTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007198260 Original CRISPR GGTGGAGGAGGGGGGTGAGA TGG (reversed) Intergenic
No off target data available for this crispr