ID: 1007198272

View in Genome Browser
Species Human (GRCh38)
Location 6:40082446-40082468
Sequence CACCTGGGACCACTCTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007198256_1007198272 30 Left 1007198256 6:40082393-40082415 CCACCGAAAAATTGCCAGAGAAG No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data
1007198257_1007198272 27 Left 1007198257 6:40082396-40082418 CCGAAAAATTGCCAGAGAAGAAT No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data
1007198260_1007198272 -4 Left 1007198260 6:40082427-40082449 CCATCTCACCCCCCTCCTCCACC No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data
1007198258_1007198272 16 Left 1007198258 6:40082407-40082429 CCAGAGAAGAATCTTTCTACCCA No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data
1007198259_1007198272 -3 Left 1007198259 6:40082426-40082448 CCCATCTCACCCCCCTCCTCCAC No data
Right 1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007198272 Original CRISPR CACCTGGGACCACTCTCAAG GGG Intergenic
No off target data available for this crispr