ID: 1007198968

View in Genome Browser
Species Human (GRCh38)
Location 6:40089023-40089045
Sequence CAGAACAAGATGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007198958_1007198968 25 Left 1007198958 6:40088975-40088997 CCGGGCAGCCTGGGTGATGAGGT No data
Right 1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG No data
1007198963_1007198968 2 Left 1007198963 6:40088998-40089020 CCACTCAGGTCAACCTCTGGGAA No data
Right 1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG No data
1007198959_1007198968 17 Left 1007198959 6:40088983-40089005 CCTGGGTGATGAGGTCCACTCAG No data
Right 1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007198968 Original CRISPR CAGAACAAGATGAAGGAGGA GGG Intergenic
No off target data available for this crispr