ID: 1007201055

View in Genome Browser
Species Human (GRCh38)
Location 6:40109473-40109495
Sequence CATGCAATCCAGGAATTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007201055_1007201061 11 Left 1007201055 6:40109473-40109495 CCTCTTAATTCCTGGATTGCATG No data
Right 1007201061 6:40109507-40109529 TCAGGGTTGATGGTTGAGGAAGG No data
1007201055_1007201059 1 Left 1007201055 6:40109473-40109495 CCTCTTAATTCCTGGATTGCATG No data
Right 1007201059 6:40109497-40109519 TTGCTTTTCTTCAGGGTTGATGG No data
1007201055_1007201057 -7 Left 1007201055 6:40109473-40109495 CCTCTTAATTCCTGGATTGCATG No data
Right 1007201057 6:40109489-40109511 TTGCATGTTTGCTTTTCTTCAGG No data
1007201055_1007201060 7 Left 1007201055 6:40109473-40109495 CCTCTTAATTCCTGGATTGCATG No data
Right 1007201060 6:40109503-40109525 TTCTTCAGGGTTGATGGTTGAGG No data
1007201055_1007201058 -6 Left 1007201055 6:40109473-40109495 CCTCTTAATTCCTGGATTGCATG No data
Right 1007201058 6:40109490-40109512 TGCATGTTTGCTTTTCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007201055 Original CRISPR CATGCAATCCAGGAATTAAG AGG (reversed) Intergenic
No off target data available for this crispr