ID: 1007212707

View in Genome Browser
Species Human (GRCh38)
Location 6:40208349-40208371
Sequence CTGAGCGATGCTGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007212707_1007212711 24 Left 1007212707 6:40208349-40208371 CCAGCAGCATCAGCATCGCTCAG No data
Right 1007212711 6:40208396-40208418 GGCCTCCCCCACAGTCCCAAGGG No data
1007212707_1007212709 3 Left 1007212707 6:40208349-40208371 CCAGCAGCATCAGCATCGCTCAG No data
Right 1007212709 6:40208375-40208397 TTATGGAAATGCAGATTCTCAGG No data
1007212707_1007212710 23 Left 1007212707 6:40208349-40208371 CCAGCAGCATCAGCATCGCTCAG No data
Right 1007212710 6:40208395-40208417 AGGCCTCCCCCACAGTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007212707 Original CRISPR CTGAGCGATGCTGATGCTGC TGG (reversed) Intergenic
No off target data available for this crispr