ID: 1007215810

View in Genome Browser
Species Human (GRCh38)
Location 6:40236214-40236236
Sequence ACTTGGAGGCAGCAAAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007215810_1007215821 23 Left 1007215810 6:40236214-40236236 CCCTGCCTTTGCTGCCTCCAAGT No data
Right 1007215821 6:40236260-40236282 CATCACTCCAGAGCTGCAGTGGG No data
1007215810_1007215820 22 Left 1007215810 6:40236214-40236236 CCCTGCCTTTGCTGCCTCCAAGT No data
Right 1007215820 6:40236259-40236281 ACATCACTCCAGAGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007215810 Original CRISPR ACTTGGAGGCAGCAAAGGCA GGG (reversed) Intergenic
No off target data available for this crispr