ID: 1007217257

View in Genome Browser
Species Human (GRCh38)
Location 6:40250031-40250053
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007217256_1007217257 6 Left 1007217256 6:40250002-40250024 CCTTGGTACTTACTCTGGAGAAG No data
Right 1007217257 6:40250031-40250053 CTCTCTTGCCACCCTCCTGCTGG No data
1007217253_1007217257 13 Left 1007217253 6:40249995-40250017 CCATTTCCCTTGGTACTTACTCT No data
Right 1007217257 6:40250031-40250053 CTCTCTTGCCACCCTCCTGCTGG No data
1007217252_1007217257 14 Left 1007217252 6:40249994-40250016 CCCATTTCCCTTGGTACTTACTC No data
Right 1007217257 6:40250031-40250053 CTCTCTTGCCACCCTCCTGCTGG No data
1007217255_1007217257 7 Left 1007217255 6:40250001-40250023 CCCTTGGTACTTACTCTGGAGAA No data
Right 1007217257 6:40250031-40250053 CTCTCTTGCCACCCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007217257 Original CRISPR CTCTCTTGCCACCCTCCTGC TGG Intergenic
No off target data available for this crispr