ID: 1007218469

View in Genome Browser
Species Human (GRCh38)
Location 6:40259919-40259941
Sequence ATTGAGGAATGGTGGCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007218469_1007218474 -3 Left 1007218469 6:40259919-40259941 CCCATTTGCCACCATTCCTCAAT No data
Right 1007218474 6:40259939-40259961 AATGATTATCTCTAATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007218469 Original CRISPR ATTGAGGAATGGTGGCAAAT GGG (reversed) Intergenic
No off target data available for this crispr