ID: 1007219178

View in Genome Browser
Species Human (GRCh38)
Location 6:40265056-40265078
Sequence CTCCAACACCAGCACCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007219173_1007219178 29 Left 1007219173 6:40265004-40265026 CCTTTCAAAAAGGAATTTGCTGT No data
Right 1007219178 6:40265056-40265078 CTCCAACACCAGCACCTTCAGGG No data
1007219172_1007219178 30 Left 1007219172 6:40265003-40265025 CCCTTTCAAAAAGGAATTTGCTG No data
Right 1007219178 6:40265056-40265078 CTCCAACACCAGCACCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007219178 Original CRISPR CTCCAACACCAGCACCTTCA GGG Intergenic
No off target data available for this crispr