ID: 1007220584

View in Genome Browser
Species Human (GRCh38)
Location 6:40275769-40275791
Sequence CAGGGTAAAGAAAGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007220584_1007220590 4 Left 1007220584 6:40275769-40275791 CCCTACTCCCTTTCTTTACCCTG No data
Right 1007220590 6:40275796-40275818 GTATTTTGTGATCTCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007220584 Original CRISPR CAGGGTAAAGAAAGGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr