ID: 1007220950

View in Genome Browser
Species Human (GRCh38)
Location 6:40278311-40278333
Sequence CCCTGTAAGGACAAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007220942_1007220950 30 Left 1007220942 6:40278258-40278280 CCTGAGAAATGTGGAGGAGCTAG No data
Right 1007220950 6:40278311-40278333 CCCTGTAAGGACAAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007220950 Original CRISPR CCCTGTAAGGACAAGTATGA GGG Intergenic
No off target data available for this crispr